
셀타젠 Genetic Genotyping

TDGF1 Rabbit Polyclonal Antibody

TDGF1 Rabbit Polyclonal Antibody

TDGF1 Polyclonal Antibody

ABP60649-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TDGF1 protein at amino acid sequence of 21-70
  • Applications tips:
Description: A polyclonal antibody for detection of TDGF1 from Human. This TDGF1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TDGF1 protein at amino acid sequence of 21-70

TDGF1 Polyclonal Antibody

ABP60649-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TDGF1 protein at amino acid sequence of 21-70
  • Applications tips:
Description: A polyclonal antibody for detection of TDGF1 from Human. This TDGF1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TDGF1 protein at amino acid sequence of 21-70

TDGF1 Polyclonal Antibody

ES11380-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TDGF1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

TDGF1 Polyclonal Antibody

ES11380-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TDGF1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

TDGF1 Rabbit pAb

A1065-100ul 100 ul
EUR 308

TDGF1 Rabbit pAb

A1065-200ul 200 ul
EUR 459

TDGF1 Rabbit pAb

A1065-20ul 20 ul
EUR 183

TDGF1 Rabbit pAb

A1065-50ul 50 ul
EUR 223

TDGF1 Rabbit pAb

A11415-100ul 100 ul
EUR 308

TDGF1 Rabbit pAb

A11415-200ul 200 ul
EUR 459

TDGF1 Rabbit pAb

A11415-20ul 20 ul
EUR 183

TDGF1 Rabbit pAb

A11415-50ul 50 ul
EUR 223

Human Teratocarcinoma Derived Growth Factor 1 (TDGF1) ELISA Kit

DLR-TDGF1-Hu-48T 48T
EUR 463
  • Should the Human Teratocarcinoma Derived Growth Factor 1 (TDGF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Teratocarcinoma Derived Growth Factor 1 (TDGF1) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Teratocarcinoma Derived Growth Factor 1 (TDGF1) ELISA Kit

DLR-TDGF1-Hu-96T 96T
EUR 599
  • Should the Human Teratocarcinoma Derived Growth Factor 1 (TDGF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Teratocarcinoma Derived Growth Factor 1 (TDGF1) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Teratocarcinoma Derived Growth Factor 1 (TDGF1) ELISA Kit

RD-TDGF1-Hu-48Tests 48 Tests
EUR 460

Human Teratocarcinoma Derived Growth Factor 1 (TDGF1) ELISA Kit

RD-TDGF1-Hu-96Tests 96 Tests
EUR 636

Human Teratocarcinoma Derived Growth Factor 1 (TDGF1) ELISA Kit

RDR-TDGF1-Hu-48Tests 48 Tests
EUR 481

Human Teratocarcinoma Derived Growth Factor 1 (TDGF1) ELISA Kit

RDR-TDGF1-Hu-96Tests 96 Tests
EUR 665

Rabbit TDGF1 ELISA Kit

ERTT0113 96Tests
EUR 521

TDGF1 Antibody

37506-100ul 100ul
EUR 252

TDGF1 antibody

38173-100ul 100ul
EUR 252

TDGF1 antibody

10R-11054 100 ug
EUR 349
Description: Mouse monoclonal TDGF1 antibody

TDGF1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TDGF1. Recognizes TDGF1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

TDGF1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TDGF1. Recognizes TDGF1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

TDGF1 Antibody

DF6210 200ul
EUR 304
Description: TDGF1 Antibody detects endogenous levels of total TDGF1.

TDGF1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TDGF1. Recognizes TDGF1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:100

TDGF1 antibody

70R-35633 100 ug
EUR 349
Description: Rabbit polyclonal TDGF1 antibody

TDGF1 Antibody

BF0656 200ul
EUR 376
Description: TDGF1 antibody detects endogenous levels of total TDGF1.

TDGF1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TDGF1. Recognizes TDGF1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

TDGF1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TDGF1. Recognizes TDGF1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

TDGF1 Antibody

ABD6210 100 ug
EUR 438

TDGF1 Polyclonal Antibody, HRP Conjugated

A54134 100 µg
EUR 570.55
Description: The best epigenetics products

TDGF1 Polyclonal Antibody, FITC Conjugated

A54135 100 µg
EUR 570.55
Description: kits suitable for this type of research

TDGF1 Polyclonal Antibody, Biotin Conjugated

A54136 100 µg
EUR 570.55
Description: fast delivery possible

TDGF1 Polyclonal Antibody, HRP Conjugated

A54138 100 µg
EUR 570.55
Description: fast delivery possible

TDGF1 Polyclonal Antibody, FITC Conjugated

A54139 100 µg
EUR 570.55
Description: reagents widely cited

TDGF1 Polyclonal Antibody, Biotin Conjugated

A54140 100 µg
EUR 570.55
Description: Ask the seller for details

Polyclonal (Mouse) Tdgf1 Antibody (N-term)

APR14743G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human (Mouse) Tdgf1 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal (Mouse) Tdgf1 Antibody (N-term)

APR14744G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human (Mouse) Tdgf1 (N-term). This antibody is tested and proven to work in the following applications:

TDGF1 Conjugated Antibody

C37506 100ul
EUR 397

Anti-TDGF1 antibody

STJ25802 100 µl
EUR 277
Description: This gene encodes an epidermal growth factor-related protein that contains a cripto, FRL-1, and cryptic domain. The encoded protein is an extracellular, membrane-bound signaling protein that plays an essential role in embryonic development and tumor growth. Mutations in this gene are associated with forebrain defects. Pseudogenes of this gene are found on chromosomes 2, 3, 6, 8, 19 and X. Alternate splicing results in multiple transcript variants.

Anti-TDGF1 antibody

STJ113789 100 µl
EUR 277
Description: This gene encodes an epidermal growth factor-related protein that contains a cripto, FRL-1, and cryptic domain. The encoded protein is an extracellular, membrane-bound signaling protein that plays an essential role in embryonic development and tumor growth. Mutations in this gene are associated with forebrain defects. Pseudogenes of this gene are found on chromosomes 2, 3, 6, 8, 19 and X. Alternate splicing results in multiple transcript variants.

Anti-TDGF1 antibody

STJ192538 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TDGF1

TDGF1 protein

30R-2570 10 ug
EUR 358
Description: Purified recombinant Human TDGF1 protein


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA27376 50 ug
EUR 363
Description: Mouse polyclonal to TDGF1

TDGF1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TDGF1. Recognizes TDGF1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TDGF1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TDGF1. Recognizes TDGF1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TDGF1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TDGF1. Recognizes TDGF1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TDGF1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TDGF1. Recognizes TDGF1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TDGF1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TDGF1. Recognizes TDGF1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TDGF1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TDGF1. Recognizes TDGF1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TDGF1, human recombinant

EUR 294

TDGF1, human recombinant

EUR 9293

TDGF1, human recombinant

EUR 914

TDGF1 Blocking Peptide

DF6210-BP 1mg
EUR 195

TDGF1 Blocking Peptide

BF0656-BP 1mg
EUR 195

TDGF1 cloning plasmid

CSB-CL023343HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 567
  • Sequence: atggactgcaggaagatggcccgcttctcttacagtgtgatttggatcatggccatttctaaagcctttgaactgggattagttgccgggctgggccatcaggaatttgctcgtccatctcggggatacctggccttcagagatgacagcatttggccccaggaggagcctgcaat
  • Show more
Description: A cloning plasmid for the TDGF1 gene.

TDGF1 cloning plasmid

CSB-CL023343HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 567
  • Sequence: atggactgcaggaagatggcccgcttctcttacagtgtgatttggatcatggccatttctaaagcctttgaactgggattagttgccgggctgggccatcaggaatttgctcgtccatctcggggatacctggccttcagagatgacagcatttggccccaggaggagcctgcaat
  • Show more
Description: A cloning plasmid for the TDGF1 gene.

TDGF1 protein (His tag)

80R-3387 50 ug
EUR 257
Description: Purified recombinant TDGF1 protein (His tag)


EHT0113 96Tests
EUR 521


ELA-E1129h 96 Tests
EUR 824

Bovine TDGF1 ELISA Kit

EBT0113 96Tests
EUR 521

Anserine TDGF1 ELISA Kit

EAT0113 96Tests
EUR 521

Chicken TDGF1 ELISA Kit

ECKT0113 96Tests
EUR 521

Canine TDGF1 ELISA Kit

ECT0113 96Tests
EUR 521


EGTT0113 96Tests
EUR 521


EF003474 96 Tests
EUR 689

Human TDGF1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EST0113 96Tests
EUR 521

Porcine TDGF1 ELISA Kit

EPT0113 96Tests
EUR 521


ERT0113 96Tests
EUR 521

Monkey TDGF1 ELISA Kit

EMKT0113 96Tests
EUR 521


EMT0113 96Tests
EUR 521

TDGF1 Recombinant Protein (Human)

RP031219 100 ug Ask for price

TDGF1 Recombinant Protein (Human)

RP031222 100 ug Ask for price

TDGF1 Recombinant Protein (Mouse)

RP178010 100 ug Ask for price

Rabbit Teratocarcinoma Derived Growth Factor 1 (TDGF1) ELISA Kit

abx362580-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Teratocarcinoma Derived Growth Factor 1 (TDGF1) Antibody

  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Teratocarcinoma-Derived Growth Factor 1 (TDGF1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Teratocarcinoma-Derived Growth Factor 1 (TDGF1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Teratocarcinoma Derived Growth Factor 1 (TDGF1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Teratocarcinoma Derived Growth Factor 1 (TDGF1) Antibody

abx037037-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Teratocarcinoma Derived Growth Factor 1 (TDGF1) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Teratocarcinoma Derived Growth Factor 1 (TDGF1) Antibody

abx012114-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Teratocarcinoma Derived Growth Factor 1 (TDGF1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Teratocarcinoma Derived Growth Factor 1 (TDGF1) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Teratocarcinoma Derived Growth Factor 1 (TDGF1) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Teratocarcinoma Derived Growth Factor 1 (TDGF1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Guinea Pig TDGF1 ELISA Kit

EGT0113 96Tests
EUR 521

m TDGF1 inducible lentiviral particles

LVP619 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing mouse target: TDGF1 (teratocarcinoma-derived growth factor 1), [alternative names: CR1; cripto]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_011562.2. It also contains a RFP-Blasticidin dual selection marker.

TDGF1 ORF Vector (Human) (pORF)

ORF010407 1.0 ug DNA
EUR 95

TDGF1 ORF Vector (Human) (pORF)

ORF010408 1.0 ug DNA
EUR 95

Tdgf1 ORF Vector (Mouse) (pORF)

ORF059338 1.0 ug DNA
EUR 506

Recombinant Human Cripto/TDGF1 Protein

RP00202 5 μg
EUR 213

TDGF1 ELISA Kit (Mouse) (OKBB00965)

OKBB00965 96 Wells
EUR 505
Description: Description of target: Teratocarcinoma-derived growth factor 1 is a protein that in humans is encoded by the TDGF1 gene. It is mapped to 3p23-p21. The protein is an extracellular, membrane-bound signaling protein that plays an essential role in embryonic developmentand tumor growth. Mutations in this gene are associated with forebrain defects. Pseudogenes of this gene are found on chromosomes 2, 3, 6, 8, 19 and X. Alternate splicing results in multiple transcript variants.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

TDGF1 ELISA Kit (Human) (OKCD08874)

OKCD08874 96 Wells
EUR 975
Description: Description of target: This gene encodes an epidermal growth factor-related protein that contains a cripto, FRL-1, and cryptic domain. The encoded protein is an extracellular, membrane-bound signaling protein that plays an essential role in embryonic development and tumor growth. Mutations in this gene are associated with forebrain defects. Pseudogenes of this gene are found on chromosomes 2, 3, 6, 8, 19 and X. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 32pg/mL

TDGF1 ELISA Kit (Rat) (OKEI00855)

OKEI00855 96 Wells
EUR 767
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 46.9 pg/mL

TDGF1 ELISA Kit (Mouse) (OKEH04458)

OKEH04458 96 Wells
EUR 662
Description: Description of target: Could play a role in the determination of the epiblastic cells that subsequently give rise to the mesoderm.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.64 pg/mL

TDGF1 ELISA Kit (Human) (OKEH04459)

OKEH04459 96 Wells
EUR 662
Description: Description of target: This gene encodes an epidermal growth factor-related protein that contains a cripto, FRL-1, and cryptic domain. The encoded protein is an extracellular, membrane-bound signaling protein that plays an essential role in embryonic development and tumor growth. Mutations in this gene are associated with forebrain defects. Pseudogenes of this gene are found on chromosomes 2, 3, 6, 8, 19 and X. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 21.8 pg/mL

Teratocarcinoma Derived Growth Factor 1 (TDGF1) Antibody Pair

abx117572-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

ELISA kit for Mouse Cripto/TDGF1

EK5651 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Cripto/TDGF1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse Cripto/TDGF1 PicoKine ELISA Kit

EK1405 96 wells
EUR 425
Description: For quantitative detection of mouse Cripto in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

TDGF1 sgRNA CRISPR Lentivector set (Human)

K2353401 3 x 1.0 ug
EUR 339

Tdgf1 sgRNA CRISPR Lentivector set (Mouse)

K4695701 3 x 1.0 ug
EUR 339

Human TeRatocarcinoma-derived growth factor 1 (TDGF1)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 40.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human TeRatocarcinoma-derived growth factor 1(TDGF1),partial expressed in E.coli

Human TeRatocarcinoma-derived growth factor 1 (TDGF1)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 17.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human TeRatocarcinoma-derived growth factor 1(TDGF1),partial expressed in E.coli

TDGF1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2353402 1.0 ug DNA
EUR 154

TDGF1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2353403 1.0 ug DNA
EUR 154

TDGF1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2353404 1.0 ug DNA
EUR 154

Human CellExp? TDGF1, Fc Tag, human recombinant

EUR 213

Tdgf1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4695702 1.0 ug DNA
EUR 154

Tdgf1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4695703 1.0 ug DNA
EUR 154

Tdgf1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4695704 1.0 ug DNA
EUR 154

TDGF1 Protein Vector (Human) (pPB-C-His)

PV041625 500 ng
EUR 329

TDGF1 Protein Vector (Human) (pPB-N-His)

PV041626 500 ng
EUR 329

TDGF1 Rabbit Polyclonal Antibody