
셀타젠 Genetic Genotyping

TIA1 Rabbit Polyclonal Antibody

TIA1 Rabbit Polyclonal Antibody

TIA1 Polyclonal Antibody

ABP60680-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TIA1 protein at amino acid sequence of 201-250
  • Applications tips:
Description: A polyclonal antibody for detection of TIA1 from Human, Mouse. This TIA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TIA1 protein at amino acid sequence of 201-250

TIA1 Polyclonal Antibody

ABP60680-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TIA1 protein at amino acid sequence of 201-250
  • Applications tips:
Description: A polyclonal antibody for detection of TIA1 from Human, Mouse. This TIA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TIA1 protein at amino acid sequence of 201-250

TIA1 Rabbit pAb

A12517-100ul 100 ul
EUR 308

TIA1 Rabbit pAb

A12517-200ul 200 ul
EUR 459

TIA1 Rabbit pAb

A12517-20ul 20 ul
EUR 183

TIA1 Rabbit pAb

A12517-50ul 50 ul
EUR 223

TIA1 Rabbit pAb

A12523-100ul 100 ul
EUR 308

TIA1 Rabbit pAb

A12523-200ul 200 ul
EUR 459

TIA1 Rabbit pAb

A12523-20ul 20 ul
EUR 183

TIA1 Rabbit pAb

A12523-50ul 50 ul
EUR 223

TIA1 Rabbit pAb

A6237-100ul 100 ul
EUR 308

TIA1 Rabbit pAb

A6237-200ul 200 ul
EUR 459

TIA1 Rabbit pAb

A6237-20ul 20 ul
EUR 183

TIA1 Rabbit pAb

A6237-50ul 50 ul
EUR 223

Anti-TIA1 Rabbit Monoclonal Antibody

M02763-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal TIA1 Antibody. Validated in IP, IF, WB and tested in Human, Mouse.

TIA1 antibody

70R-5035 50 ug
EUR 467
Description: Rabbit polyclonal TIA1 antibody raised against the N terminal of TIA1

TIA1 antibody

70R-5036 50 ug
EUR 467
Description: Rabbit polyclonal TIA1 antibody raised against the C terminal of TIA1

TIA1 antibody

70R-20819 50 ul
EUR 435
Description: Rabbit polyclonal TIA1 antibody

TIA1 antibody

38767-100ul 100ul
EUR 252

TIA1 Antibody

49472-100ul 100ul
EUR 333

TIA1 Antibody

49472-50ul 50ul
EUR 239

TIA1 Antibody

43541-100ul 100ul
EUR 252

TIA1 Antibody

DF12176 200ul
EUR 304
Description: TIA1 antibody detects endogenous levels of TIA1.

TIA1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TIA1. Recognizes TIA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IP:1:200-1:2000

TIA1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TIA1. Recognizes TIA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal Goat Anti-TIA1 Antibody

APG00331G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-TIA1 . This antibody is tested and proven to work in the following applications:

TIA1 Conjugated Antibody

C38767 100ul
EUR 397

TIA1 Conjugated Antibody

C43541 100ul
EUR 397

TIA1 Conjugated Antibody

C49472 100ul
EUR 397

anti- TIA1 antibody

FNab08685 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • IF: 1:20 - 1:100
  • Immunogen: TIA1 cytotoxic granule-associated RNA binding protein
  • Uniprot ID: P31483
  • Gene ID: 7072
  • Research Area: Cancer, Immunology, Metabolism
Description: Antibody raised against TIA1

Anti-TIA1 antibody

PAab08685 100 ug
EUR 386

Anti-TIA1 Antibody

PA2194 100ug/vial
EUR 294

Anti-TIA1 Antibody

STJ503251 100 µg
EUR 476

Anti-TIA1 Antibody

STJ503252 100 µg
EUR 476

Anti-TIA1 antibody

STJ71153 100 µg
EUR 359

Anti-TIA1 antibody

STJ27993 100 µl
EUR 277
Description: The product encoded by this gene is a member of a RNA-binding protein family and possesses nucleolytic activity against cytotoxic lymphocyte (CTL) target cells. It has been suggested that this protein may be involved in the induction of apoptosis as it preferentially recognizes poly(A) homopolymers and induces DNA fragmentation in CTL targets. The major granule-associated species is a 15-kDa protein that is thought to be derived from the carboxyl terminus of the 40-kDa product by proteolytic processing. Alternative splicing resulting in different isoforms of this gene product has been described in the literature.

Anti-TIA1 antibody

STJ114391 100 µl
EUR 277
Description: The product encoded by this gene is a member of a RNA-binding protein family and possesses nucleolytic activity against cytotoxic lymphocyte (CTL) target cells. It has been suggested that this protein may be involved in the induction of apoptosis as it preferentially recognizes poly(A) homopolymers and induces DNA fragmentation in CTL targets. The major granule-associated species is a 15-kDa protein that is thought to be derived from the carboxyl terminus of the 40-kDa product by proteolytic processing. Alternative splicing resulting in different isoforms of this gene product has been described in the literature.

Anti-TIA1 antibody

STJ114397 100 µl
EUR 277
Description: The product encoded by this gene is a member of a RNA-binding protein family and possesses nucleolytic activity against cytotoxic lymphocyte (CTL) target cells. It has been suggested that this protein may be involved in the induction of apoptosis as it preferentially recognizes poly(A) homopolymers and induces DNA fragmentation in CTL targets. The major granule-associated species is a 15-kDa protein that is thought to be derived from the carboxyl terminus of the 40-kDa product by proteolytic processing. Alternative splicing resulting in different isoforms of this gene product has been described in the literature.

Anti-TIA1 antibody

STJ192549 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TIA1

Anti-TIA1 Antibody Clone TIA1/1313, Unconjugated-20ug

7072-MSM1-P0 20ug
EUR 233

Anti-TIA1 Antibody Clone TIA1/1313, Unconjugated-100ug

7072-MSM1-P1 100ug
EUR 428


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pENTR223- TIA1

PVT10099 2 ug
EUR 266


YF-PA15031 50 ul
EUR 363
Description: Mouse polyclonal to TIA1


YF-PA15032 50 ug
EUR 363
Description: Mouse polyclonal to TIA1


YF-PA15033 100 ul
EUR 403
Description: Rabbit polyclonal to TIA1

Rabbit Anti-TIA1 monoclonal antibody, clone KN53-22

CABT-L930 100 ul
EUR 777

TIA1 recombinant monoclonal antibody

A5775 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human TIA1 for WB, IHC,ELISA

Anti-TIA1 Antibody (Biotin)

STJ503253 100 µg
EUR 586

Anti-TIA1 Antibody (FITC)

STJ503254 100 µg
EUR 586

Anti-TIA1 Antibody (Biotin)

STJ503255 100 µg
EUR 586

Anti-TIA1 Antibody (FITC)

STJ503256 100 µg
EUR 586

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC551313-100 100uL
EUR 199
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF555 conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC551313-500 500uL
EUR 544
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF555 conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC611313-100 100uL
EUR 199
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF660R conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC611313-500 500uL
EUR 544
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF660R conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC401313-100 100uL
EUR 199
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF640R conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC401313-500 500uL
EUR 544
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF640R conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC431313-100 100uL
EUR 199
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF543 conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC431313-500 500uL
EUR 544
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF543 conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC471313-100 100uL
EUR 199
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF647 conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC471313-500 500uL
EUR 544
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF647 conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC051313-100 100uL
EUR 199
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF405M conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC051313-500 500uL
EUR 544
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF405M conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC041313-100 100uL
EUR 199
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF405S conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC041313-500 500uL
EUR 544
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF405S conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNUB1313-100 100uL
EUR 209
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313), Concentration: 0.2mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNUB1313-500 500uL
EUR 458
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313), Concentration: 0.2mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNUM1313-50 50uL
EUR 395
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313), 1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC681313-100 100uL
EUR 199
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF568 conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC681313-500 500uL
EUR 544
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF568 conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC701313-100 100uL
EUR 199
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF770 conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC701313-500 500uL
EUR 544
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF770 conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC881313-100 100uL
EUR 199
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF488A conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC881313-500 500uL
EUR 544
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF488A conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC941313-100 100uL
EUR 199
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF594 conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC941313-500 500uL
EUR 544
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF594 conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNCB1313-100 100uL
EUR 199
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),Biotin conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNCB1313-500 500uL
EUR 544
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),Biotin conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNCH1313-100 100uL
EUR 199
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNCH1313-500 500uL
EUR 544
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC801313-100 100uL
EUR 199
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF680 conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC801313-500 500uL
EUR 544
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF680 conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNCP1313-250 250uL
EUR 383
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),PerCP conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNCR1313-250 250uL
EUR 383
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),RPE conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNCA1313-250 250uL
EUR 383
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),APC conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNCAP1313-100 100uL
EUR 199
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNCAP1313-500 500uL
EUR 544
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC811313-100 100uL
EUR 199
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF680R conjugate, Concentration: 0.1mg/mL

TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313) Antibody

BNC811313-500 500uL
EUR 544
Description: Primary antibody against TIA1 (T-Cell-Restricted Intracellular Antigen-1) (TIA1/1313),CF680R conjugate, Concentration: 0.1mg/mL

TIA1 cloning plasmid

CSB-CL023527HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 645
  • Sequence: atggaggacgagatgcccaagactctatacgtcggtaacctttccagagatgtgacagaagctctaattctgcaactctttagccagattggaccttgtaaaaactgcaaaatgattatggatacagctggaaatgatccctattgttttgtggagtttcatgagcatcgtcatgc
  • Show more
Description: A cloning plasmid for the TIA1 gene.

TIA1 Blocking Peptide

33R-6040 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TIA1 antibody, catalog no. 70R-5035

TIA1 Blocking Peptide

33R-7484 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TIA1 antibody, catalog no. 70R-5036

TIA1 Blocking Peptide

DF12176-BP 1mg
EUR 195


PVT13169 2 ug
EUR 391


EF003599 96 Tests
EUR 689

Human TIA1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse TIA1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TIA1 Recombinant Protein (Human)

RP031537 100 ug Ask for price

TIA1 Recombinant Protein (Rat)

RP233102 100 ug Ask for price

TIA1 Recombinant Protein (Mouse)

RP178679 100 ug Ask for price

TIA1 Recombinant Protein (Mouse)

RP178682 100 ug Ask for price

TIA1 Recombinant Protein (Mouse)

RP178685 100 ug Ask for price

Nucleolysin TIA-1 Isoform P40 (TIA1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nucleolysin TIA-1 Isoform P40 (TIA1) Antibody

abx122851-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Nucleolysin TIA-1 Isoform P40 (TIA1) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nucleolysin TIA-1 Isoform P40 (TIA1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nucleolysin TIA-1 Isoform P40 (TIA1) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nucleolysin TIA-1 Isoform P40 (TIA1) Antibody

abx431671-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Nucleolysin TIA-1 Isoform P40 (TIA1) Antibody

abx238685-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Tia1 ORF Vector (Mouse) (pORF)

ORF059561 1.0 ug DNA
EUR 506

Tia1 ORF Vector (Mouse) (pORF)

ORF059562 1.0 ug DNA
EUR 506

Tia1 ORF Vector (Mouse) (pORF)

ORF059563 1.0 ug DNA
EUR 506

TIA1 ORF Vector (Human) (pORF)

ORF010513 1.0 ug DNA
EUR 95

Tia1 ORF Vector (Rat) (pORF)

ORF077702 1.0 ug DNA
EUR 506

Mouse Anti-Human TIA1 monoclonal antibody, clone JID786

CABT-L2816-100uL500uL 100 uL, 500 uL
EUR 502

TIA1 sgRNA CRISPR Lentivector set (Human)

K2372501 3 x 1.0 ug
EUR 339

Tia1 sgRNA CRISPR Lentivector set (Mouse)

K4931401 3 x 1.0 ug
EUR 339

Tia1 sgRNA CRISPR Lentivector set (Rat)

K6339901 3 x 1.0 ug
EUR 339

Mouse Nucleolysin TIA- 1, Tia1 ELISA KIT

ELI-52046m 96 Tests
EUR 865

TIA1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2372502 1.0 ug DNA
EUR 154

TIA1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2372503 1.0 ug DNA
EUR 154

TIA1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2372504 1.0 ug DNA
EUR 154

Tia1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4931402 1.0 ug DNA
EUR 154

Tia1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4931403 1.0 ug DNA
EUR 154

Tia1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4931404 1.0 ug DNA
EUR 154

TIA1 Rabbit Polyclonal Antibody