셀타젠 Genetic Genotyping

TIMD4 Rabbit Polyclonal Antibody

TIMD4 Polyclonal Antibody

ABP60693-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TIMD4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TIMD4 from Human, Mouse. This TIMD4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TIMD4 protein

TIMD4 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIMD4. Recognizes TIMD4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

Anti-TIMD4 antibody

STJ192317 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TIMD4

Human T-Cell Immunoglobulin And Mucin Domain Containing Protein 4 (TIMD4) ELISA Kit

DLR-TIMD4-Hu-48T 48T
EUR 517
  • Should the Human T-Cell Immunoglobulin And Mucin Domain Containing Protein 4 (TIMD4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human T-Cell Immunoglobulin And Mucin Domain Containing Protein 4 (TIMD4) in samples from tissue homogenates, cell lysates or other biological fluids.

Human T-Cell Immunoglobulin And Mucin Domain Containing Protein 4 (TIMD4) ELISA Kit

DLR-TIMD4-Hu-96T 96T
EUR 673
  • Should the Human T-Cell Immunoglobulin And Mucin Domain Containing Protein 4 (TIMD4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human T-Cell Immunoglobulin And Mucin Domain Containing Protein 4 (TIMD4) in samples from tissue homogenates, cell lysates or other biological fluids.

Human T-Cell Immunoglobulin And Mucin Domain Containing Protein 4 (TIMD4) ELISA Kit

RDR-TIMD4-Hu-48Tests 48 Tests
EUR 544

Human T-Cell Immunoglobulin And Mucin Domain Containing Protein 4 (TIMD4) ELISA Kit

RDR-TIMD4-Hu-96Tests 96 Tests
EUR 756

Human T-Cell Immunoglobulin And Mucin Domain Containing Protein 4 (TIMD4) ELISA Kit

RD-TIMD4-Hu-48Tests 48 Tests
EUR 521

Human T-Cell Immunoglobulin And Mucin Domain Containing Protein 4 (TIMD4) ELISA Kit

RD-TIMD4-Hu-96Tests 96 Tests
EUR 723


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Polyclonal TIMD4 / TIM4 / TIM-4 Antibody (Internal)

APR02384G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TIMD4 / TIM4 / TIM-4 (Internal). This antibody is tested and proven to work in the following applications:

TIMD4 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIMD4. Recognizes TIMD4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TIMD4 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIMD4. Recognizes TIMD4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TIMD4 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIMD4. Recognizes TIMD4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal TIMD4 / TIM4 / TIM-4 Antibody (C-Terminus)

APR02278G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TIMD4 / TIM4 / TIM-4 (C-Terminus). This antibody is tested and proven to work in the following applications:

TIMD4 cloning plasmid

CSB-CL850304HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1137
  • Sequence: atgtccaaagaacctctcattctctggctgatgattgagttttggtggctttacctgacaccagtcacttcagagactgttgtgacggaggttttgggtcaccgggtgactttgccctgtctgtactcatcctggtctcacaacagcaacagcatgtgctgggggaaagaccagt
  • Show more
Description: A cloning plasmid for the TIMD4 gene.

Mouse TIMD4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TIMD4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Timd4 ELISA KIT

ELI-29221m 96 Tests
EUR 865


ELI-29375h 96 Tests
EUR 824

TIMD4 Recombinant Protein (Human)

RP031561 100 ug Ask for price

TIMD4 Recombinant Protein (Mouse)

RP178748 100 ug Ask for price


PVT18015 2 ug
EUR 258


PVT12945 2 ug
EUR 391

TIMD4 Rabbit Polyclonal Antibody