TIMD4 Rabbit Polyclonal Antibody
TIMD4 Polyclonal Antibody |
ABP60693-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human TIMD4 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of TIMD4 from Human, Mouse. This TIMD4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TIMD4 protein |
TIMD4 Antibody |
1-CSB-PA850304LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TIMD4. Recognizes TIMD4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200 |
Anti-TIMD4 antibody |
STJ192317 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to TIMD4 |
Human T-Cell Immunoglobulin And Mucin Domain Containing Protein 4 (TIMD4) ELISA Kit |
DLR-TIMD4-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human T-Cell Immunoglobulin And Mucin Domain Containing Protein 4 (TIMD4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human T-Cell Immunoglobulin And Mucin Domain Containing Protein 4 (TIMD4) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human T-Cell Immunoglobulin And Mucin Domain Containing Protein 4 (TIMD4) ELISA Kit |
DLR-TIMD4-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human T-Cell Immunoglobulin And Mucin Domain Containing Protein 4 (TIMD4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human T-Cell Immunoglobulin And Mucin Domain Containing Protein 4 (TIMD4) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human T-Cell Immunoglobulin And Mucin Domain Containing Protein 4 (TIMD4) ELISA Kit |
RDR-TIMD4-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human T-Cell Immunoglobulin And Mucin Domain Containing Protein 4 (TIMD4) ELISA Kit |
RDR-TIMD4-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human T-Cell Immunoglobulin And Mucin Domain Containing Protein 4 (TIMD4) ELISA Kit |
RD-TIMD4-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human T-Cell Immunoglobulin And Mucin Domain Containing Protein 4 (TIMD4) ELISA Kit |
RD-TIMD4-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
TIMD4 siRNA |
20-abx936786 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TIMD4 siRNA |
20-abx936787 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Polyclonal TIMD4 / TIM4 / TIM-4 Antibody (Internal) |
APR02384G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TIMD4 / TIM4 / TIM-4 (Internal). This antibody is tested and proven to work in the following applications: |
TIMD4 Antibody, HRP conjugated |
1-CSB-PA850304LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TIMD4. Recognizes TIMD4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
TIMD4 Antibody, FITC conjugated |
1-CSB-PA850304LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TIMD4. Recognizes TIMD4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
TIMD4 Antibody, Biotin conjugated |
1-CSB-PA850304LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TIMD4. Recognizes TIMD4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Polyclonal TIMD4 / TIM4 / TIM-4 Antibody (C-Terminus) |
APR02278G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TIMD4 / TIM4 / TIM-4 (C-Terminus). This antibody is tested and proven to work in the following applications: |
TIMD4 cloning plasmid |
CSB-CL850304HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1137
- Sequence: atgtccaaagaacctctcattctctggctgatgattgagttttggtggctttacctgacaccagtcacttcagagactgttgtgacggaggttttgggtcaccgggtgactttgccctgtctgtactcatcctggtctcacaacagcaacagcatgtgctgggggaaagaccagt
- Show more
|
Description: A cloning plasmid for the TIMD4 gene. |
Mouse TIMD4 shRNA Plasmid |
20-abx983161 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human TIMD4 shRNA Plasmid |
20-abx964091 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
TIMD4 Recombinant Protein (Human) |
RP031561 |
ABM |
100 ug |
Ask for price |
TIMD4 Recombinant Protein (Mouse) |
RP178748 |
ABM |
100 ug |
Ask for price |
TIMD4 Rabbit Polyclonal Antibody