TPP1 Rabbit Polyclonal Antibody
TPP1 Polyclonal Antibody |
ES11280-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against TPP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
TPP1 Polyclonal Antibody |
ES11280-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against TPP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Human Tripeptidyl Peptidase I (TPP1) ELISA Kit |
DLR-TPP1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Tripeptidyl Peptidase I (TPP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Tripeptidyl Peptidase I (TPP1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Tripeptidyl Peptidase I (TPP1) ELISA Kit |
DLR-TPP1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Tripeptidyl Peptidase I (TPP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Tripeptidyl Peptidase I (TPP1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit |
DLR-TPP1-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tripeptidyl Peptidase I (TPP1) in samples from tissue homogenates or other biological fluids. |
Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit |
DLR-TPP1-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tripeptidyl Peptidase I (TPP1) in samples from tissue homogenates or other biological fluids. |
Human Tripeptidyl Peptidase I (TPP1) ELISA Kit |
RDR-TPP1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Tripeptidyl Peptidase I (TPP1) ELISA Kit |
RDR-TPP1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit |
RDR-TPP1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit |
RDR-TPP1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Human Tripeptidyl Peptidase I (TPP1) ELISA Kit |
RD-TPP1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Tripeptidyl Peptidase I (TPP1) ELISA Kit |
RD-TPP1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit |
RD-TPP1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit |
RD-TPP1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
TPP1 Rabbit pAb |
A6269-100ul |
Abclonal |
100 ul |
EUR 308 |
TPP1 Rabbit pAb |
A6269-200ul |
Abclonal |
200 ul |
EUR 459 |
TPP1 Rabbit pAb |
A6269-20ul |
Abclonal |
20 ul |
Ask for price |
TPP1 Rabbit pAb |
A6269-50ul |
Abclonal |
50 ul |
Ask for price |
TPP1 Rabbit pAb |
A5627-100ul |
Abclonal |
100 ul |
EUR 308 |
TPP1 Rabbit pAb |
A5627-200ul |
Abclonal |
200 ul |
EUR 459 |
TPP1 Rabbit pAb |
A5627-20ul |
Abclonal |
20 ul |
EUR 183 |
TPP1 Rabbit pAb |
A5627-50ul |
Abclonal |
50 ul |
EUR 223 |
TPP1 antibody |
70R-13534 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal TPP1 antibody |
TPP1 antibody |
70R-20940 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal TPP1 antibody |
TPP1 Antibody |
32932-100ul |
SAB |
100ul |
EUR 252 |
TPP1 Antibody |
DF7425 |
Affbiotech |
200ul |
EUR 304 |
Description: TPP1 Antibody detects endogenous levels of total TPP1. |
TPP1 Antibody |
1-CSB-PA024113GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against TPP1. Recognizes TPP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
TPP1 Antibody |
1-CSB-PA024113LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TPP1. Recognizes TPP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500 |
Polyclonal TPP1 Antibody (N-term) |
APR13781G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TPP1 (N-term). This antibody is tested and proven to work in the following applications: |
Polyclonal Goat Anti-CLN2 / TPP1 Antibody |
APG03348G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-CLN2 / TPP1 . This antibody is tested and proven to work in the following applications: |
TPP1 Conjugated Antibody |
C32932 |
SAB |
100ul |
EUR 397 |
anti- TPP1 antibody |
FNab08894 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: tripeptidyl peptidase I
- Uniprot ID: O14773
- Gene ID: 1200
- Research Area: Neuroscience, Metabolism
|
Description: Antibody raised against TPP1 |
Anti-TPP1 Antibody |
PB9899 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-TPP1 antibody |
STJ27594 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the sedolisin family of serine proteases. The protease functions in the lysosome to cleave N-terminal tripeptides from substrates, and has weaker endopeptidase activity. It is synthesized as a catalytically-inactive enzyme which is activated and auto-proteolyzed upon acidification. Mutations in this gene result in late-infantile neuronal ceroid lipofuscinosis, which is associated with the failure to degrade specific neuropeptides and a subunit of ATP synthase in the lysosome. |
Anti-TPP1 antibody |
STJ28191 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the sedolisin family of serine proteases. The protease functions in the lysosome to cleave N-terminal tripeptides from substrates, and has weaker endopeptidase activity. It is synthesized as a catalytically-inactive enzyme which is activated and auto-proteolyzed upon acidification. Mutations in this gene result in late-infantile neuronal ceroid lipofuscinosis, which is associated with the failure to degrade specific neuropeptides and a subunit of ATP synthase in the lysosome. |
Anti-TPP1 antibody |
STJ192438 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to TPP1 |
Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human) |
4-PAC828Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TPP1 (Met1~Pro320)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1) |
Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse) |
4-PAC828Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TPP1 (Gly198~Pro562)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1) |
TPP1 siRNA |
20-abx905753 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TPP1 siRNA |
20-abx937853 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TPP1 siRNA |
20-abx937854 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-TPP1 |
YF-PA10990 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to TPP1 |
anti-TPP1 |
YF-PA10991 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to TPP1 |
anti-TPP1 |
YF-PA10992 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to TPP1 |
anti-TPP1 |
YF-PA10993 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to TPP1 |
TPP1 Antibody, HRP conjugated |
1-CSB-PA024113LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TPP1. Recognizes TPP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
TPP1 Antibody, FITC conjugated |
1-CSB-PA024113LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TPP1. Recognizes TPP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
TPP1 Antibody, Biotin conjugated |
1-CSB-PA024113LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TPP1. Recognizes TPP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), APC |
4-PAC828Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TPP1 (Met1~Pro320)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with APC. |
Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), Biotinylated |
4-PAC828Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TPP1 (Met1~Pro320)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with Biotin. |
Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), Cy3 |
4-PAC828Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TPP1 (Met1~Pro320)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with Cy3. |
Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), FITC |
4-PAC828Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TPP1 (Met1~Pro320)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with FITC. |
Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), HRP |
4-PAC828Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TPP1 (Met1~Pro320)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with HRP. |
Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), PE |
4-PAC828Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TPP1 (Met1~Pro320)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with PE. |
Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), APC |
4-PAC828Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TPP1 (Gly198~Pro562)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with APC. |
Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), Biotinylated |
4-PAC828Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TPP1 (Gly198~Pro562)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with Biotin. |
Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), Cy3 |
4-PAC828Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TPP1 (Gly198~Pro562)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with Cy3. |
Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), FITC |
4-PAC828Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TPP1 (Gly198~Pro562)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with FITC. |
Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), HRP |
4-PAC828Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TPP1 (Gly198~Pro562)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with HRP. |
Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), PE |
4-PAC828Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TPP1 (Gly198~Pro562)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with PE. |
Rabbit Tripeptidyl Peptidase I (TPP1) ELISA Kit |
abx363635-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
TPP1 Blocking Peptide |
DF7425-BP |
Affbiotech |
1mg |
EUR 195 |
TPP1 cloning plasmid |
CSB-CL024113HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1692
- Sequence: atgggactccaagcctgcctcctagggctctttgccctcatcctctctggcaaatgcagttacagcccggagcccgaccagcggaggacgctgcccccaggctgggtgtccctgggccgtgcggaccctgaggaagagctgagtctcacctttgccctgagacagcagaatgtgg
- Show more
|
Description: A cloning plasmid for the TPP1 gene. |
Anti-TPP1 (3B1) |
YF-MA10174 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to TPP1 |
Tripeptidyl Peptidase I (TPP1) Antibody |
20-abx004789 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Tripeptidyl Peptidase I (TPP1) Antibody |
20-abx004302 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Tripeptidyl Peptidase I (TPP1) Antibody |
20-abx178719 |
Abbexa |
|
|
|
Tripeptidyl Peptidase I (TPP1) Antibody |
20-abx116291 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Tripeptidyl Peptidase I (TPP1) Antibody |
20-abx129223 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Tripeptidyl Peptidase I (TPP1) Antibody |
20-abx129835 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Tripeptidyl Peptidase I (TPP1) Antibody |
abx145299-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Tripeptidyl Peptidase I (TPP1) Antibody |
20-abx174934 |
Abbexa |
|
|
|
Tripeptidyl Peptidase I (TPP1) Antibody |
abx029244-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Tripeptidyl Peptidase I (TPP1) Antibody |
abx029244-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Tripeptidyl Peptidase I (TPP1) Antibody |
abx238894-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Tripeptidyl Peptidase I (TPP1) Antibody |
20-abx334373 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAC828Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TPP1 (Met1~Pro320)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with APC-Cy7. |
Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAC828Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TPP1 (Gly198~Pro562)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with APC-Cy7. |
Tripeptidyl Peptidase I (TPP1) Antibody (HRP) |
20-abx338092 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Tripeptidyl Peptidase I (TPP1) Antibody (FITC) |
20-abx338093 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Tripeptidyl Peptidase I (TPP1) Antibody (Biotin) |
20-abx338094 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Rat TPP1 shRNA Plasmid |
20-abx986793 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse TPP1 shRNA Plasmid |
20-abx969705 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human TPP1 shRNA Plasmid |
20-abx950857 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
TPP1 Recombinant Protein (Rat) |
RP234425 |
ABM |
100 ug |
Ask for price |
TPP1 Recombinant Protein (Human) |
RP032686 |
ABM |
100 ug |
Ask for price |
TPP1 Recombinant Protein (Mouse) |
RP180740 |
ABM |
100 ug |
Ask for price |
Monoclonal TPP1 Antibody (monoclonal) (M01), Clone: 3B1 |
APR13780G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human TPP1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3B1. This antibody is applicable in WB and IHC, E |
Human TPP1 PicoKine ELISA Kit |
EK2042 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of human TPP1 in cell culture supernates, serum and plasma (heparin, EDTA). |
Tpp1 ORF Vector (Rat) (pORF) |
ORF078143 |
ABM |
1.0 ug DNA |
EUR 506 |
TPP1 ORF Vector (Human) (pORF) |
ORF010896 |
ABM |
1.0 ug DNA |
EUR 95 |
Tpp1 ORF Vector (Mouse) (pORF) |
ORF060248 |
ABM |
1.0 ug DNA |
EUR 506 |
Recombinant Tripeptidyl Peptidase I (TPP1) |
4-RPC828Hu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O14773
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 38.2kDa
- Isoelectric Point: 5.7
|
Description: Recombinant Human Tripeptidyl Peptidase I expressed in: E.coli |
Recombinant Tripeptidyl Peptidase I (TPP1) |
4-RPC828Mu01 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O89023
- Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 43.2kDa
- Isoelectric Point: 5.9
|
Description: Recombinant Mouse Tripeptidyl Peptidase I expressed in: E.coli |
TPP1 ELISA Kit (Human) (OKAN06104) |
OKAN06104 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes a member of the sedolisin family of serine proteases. The protease functions in the lysosome to cleave N-terminal tripeptides from substrates, and has weaker endopeptidase activity. It is synthesized as a catalytically-inactive enzyme which is activated and auto-proteolyzed upon acidification. Mutations in this gene result in late-infantile neuronal ceroid lipofuscinosis, which is associated with the failure to degrade specific neuropeptides and a subunit of ATP synthase in the lysosome.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.055 ng/mL |
TPP1 ELISA Kit (Human) (OKBB01409) |
OKBB01409 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Tripeptidyl-peptidase 1, also known as Lysosomal pepstatin-insensitive protease, is an enzyme that in humans is encoded by the TPP1 gene. The human gene TPP1 encodes a member of the sedolisin family of serine proteases. The human gene has 13 exons and locates at the chromosome band 11p15. This gene encodes a member of the sedolisin family of serine proteases. The protease functions in the lysosome to cleave N-terminal tripeptides from substrates, and has weaker endopeptidase activity. It is synthesized as a catalytically-inactive enzyme which is activated and auto-proteolyzed upon acidification. Mutations in this gene result in late-infantile neuronal ceroid lipofuscinosis, which is associated with the failure to degrade specific neuropeptides and a subunit of ATP synthase in the lysosome.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml |
TPP1 ELISA Kit (Human) (OKCD00354) |
OKCD00354 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Lysosomal serine protease with tripeptidyl-peptidase I activity. May act as a non-specific lysosomal peptidase which generates tripeptides from the breakdown products produced by lysosomal proteinases. Requires substrates with an unsubstituted N-terminus (By similarity).By similarity ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL |
TPP1 ELISA Kit (Mouse) (OKCD08264) |
OKCD08264 |
Aviva Systems Biology |
96 Wells |
EUR 1001 |
Description: Description of target: This gene encodes a lysosomal serine protease that cleaves N-terminal tripeptides from protein substrates. The encoded preproprotein undergoes autocatalytic processing to generate a mature enzyme. Mice lacking the encoded protein exhibit a progressive neurodegeneration and a greatly shortened lifespan. At the cellular level, mice lacking the encoded protein exhibit accumulation of autofluorescent lipopigments. Mutations in the human ortholog of this gene cause classical late-infantile neuronal ceroid lipofuscinosis.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL |
TPP1 ELISA Kit (Human) (OKDD00573) |
OKDD00573 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: This gene encodes a member of the sedolisin family of serine proteases. The protease functions in the lysosome to cleave N-terminal tripeptides from substrates, and has weaker endopeptidase activity. It is synthesized as a catalytically-inactive enzyme which is activated and auto-proteolyzed upon acidification. Mutations in this gene result in late-infantile neuronal ceroid lipofuscinosis, which is associated with the failure to degrade specific neuropeptides and a subunit of ATP synthase in the lysosome.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.063 ng/mL |
TPP1 ELISA Kit (Mouse) (OKDD00789) |
OKDD00789 |
Aviva Systems Biology |
96 Wells |
EUR 988 |
Description: Description of target: This gene encodes a lysosomal serine protease that cleaves n-terminal tripeptides from protein substrates. the encoded preproprotein undergoes autocatalytic processing to generate a mature enzyme. mice lacking the encoded protein exhibit a progressive neurodegeneration and a greatly shortened lifespan. at the cellular level, mice lacking the encoded protein exhibit accumulation of autofluorescent lipopigments. mutations in the human ortholog of this gene cause classical late-infantile neuronal ceroid lipofuscinosis.;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.055ng/mL |
Monoclonal TPP1 / CLN2 Antibody (clone 3B1), Clone: 3B1 |
APR13779G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A Monoclonal antibody against Human TPP1 / CLN2 (clone 3B1). The antibodies are raised in Mouse and are from clone 3B1. This antibody is applicable in WB and IHC-P, E |
Human Tripeptidyl Peptidase I (TPP1) Protein |
20-abx166794 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse Tripeptidyl Peptidase I (TPP1) Protein |
20-abx167349 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Tpp1 sgRNA CRISPR Lentivector set (Rat) |
K7023501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Tpp1 sgRNA CRISPR Lentivector set (Mouse) |
K3405201 |
ABM |
3 x 1.0 ug |
EUR 339 |
TPP1 sgRNA CRISPR Lentivector set (Human) |
K2429301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Tripeptidyl Peptidase I (TPP1)ELISA Kit |
201-12-2521 |
SunredBio |
96 tests |
EUR 440 |
- This Tripeptidyl Peptidase I ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
ELISA kit for Human TPP1 (Tripeptidyl Peptidase ?) |
E-EL-H1479 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's TPP1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human TPP1. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human TPP1 (Tripeptidyl Peptidase ?) in samples from Serum, Plasma, Cell supernatant |
Human Tripeptidyl-peptidase 1(TPP1) ELISA kit |
CSB-EL024113HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Tripeptidyl-peptidase 1 (TPP1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Tripeptidyl-peptidase 1(TPP1) ELISA kit |
1-CSB-EL024113HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Tripeptidyl-peptidase 1(TPP1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Tripeptidyl Peptidase I (TPP1) CLIA Kit |
abx197847-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit |
20-abx154796 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Tripeptidyl Peptidase I (TPP1) ELISA Kit |
20-abx153364 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Tripeptidyl- peptidase 1, TPP1 ELISA KIT |
ELI-16982h |
Lifescience Market |
96 Tests |
EUR 824 |
Pig Tripeptidyl Peptidase I (TPP1) ELISA Kit |
abx360652-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Tripeptidyl Peptidase I (TPP1) ELISA Kit |
abx358322-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Monkey Tripeptidyl Peptidase I (TPP1) ELISA Kit |
abx358877-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Chicken Tripeptidyl Peptidase I (TPP1) ELISA Kit |
abx355837-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Sheep Tripeptidyl Peptidase I (TPP1) ELISA Kit |
abx364262-96tests |
Abbexa |
96 tests |
EUR 926 |
- Shipped within 5-12 working days.
|
Human Tripeptidyl Peptidase I (TPP1) CLIA Kit |
20-abx493920 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mouse Tripeptidyl Peptidase I (TPP1) CLIA Kit |
20-abx493921 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Bovine Tripeptidyl- peptidase 1, TPP1 ELISA KIT |
ELI-40084b |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Tripeptidyl- peptidase 1, Tpp1 ELISA KIT |
ELI-40085m |
Lifescience Market |
96 Tests |
EUR 865 |
Tpp1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7023502 |
ABM |
1.0 ug DNA |
EUR 154 |
Tpp1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7023503 |
ABM |
1.0 ug DNA |
EUR 154 |
Tpp1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7023504 |
ABM |
1.0 ug DNA |
EUR 154 |
Tpp1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3405202 |
ABM |
1.0 ug DNA |
EUR 154 |
Tpp1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3405203 |
ABM |
1.0 ug DNA |
EUR 154 |
Tpp1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3405204 |
ABM |
1.0 ug DNA |
EUR 154 |
TPP1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2429302 |
ABM |
1.0 ug DNA |
EUR 154 |
TPP1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2429303 |
ABM |
1.0 ug DNA |
EUR 154 |
TPP1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2429304 |
ABM |
1.0 ug DNA |
EUR 154 |
TPP1 Protein Vector (Rat) (pPB-C-His) |
PV312570 |
ABM |
500 ng |
EUR 603 |
TPP1 Protein Vector (Rat) (pPB-N-His) |
PV312571 |
ABM |
500 ng |
EUR 603 |
TPP1 Protein Vector (Rat) (pPM-C-HA) |
PV312572 |
ABM |
500 ng |
EUR 603 |
TPP1 Protein Vector (Rat) (pPM-C-His) |
PV312573 |
ABM |
500 ng |
EUR 603 |
TPP1 Protein Vector (Mouse) (pPB-C-His) |
PV240990 |
ABM |
500 ng |
EUR 603 |
TPP1 Protein Vector (Mouse) (pPB-N-His) |
PV240991 |
ABM |
500 ng |
EUR 603 |
TPP1 Protein Vector (Mouse) (pPM-C-HA) |
PV240992 |
ABM |
500 ng |
EUR 603 |
TPP1 Rabbit Polyclonal Antibody