TPP1 Rabbit Polyclonal Antibody

TPP1 Polyclonal Antibody
ES11280-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against TPP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

TPP1 Polyclonal Antibody
ES11280-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against TPP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
DLR-TPP1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Tripeptidyl Peptidase I (TPP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Tripeptidyl Peptidase I (TPP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
DLR-TPP1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Tripeptidyl Peptidase I (TPP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Tripeptidyl Peptidase I (TPP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit
DLR-TPP1-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tripeptidyl Peptidase I (TPP1) in samples from tissue homogenates or other biological fluids.

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit
DLR-TPP1-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tripeptidyl Peptidase I (TPP1) in samples from tissue homogenates or other biological fluids.

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
RDR-TPP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
RDR-TPP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit
RDR-TPP1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit
RDR-TPP1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
RD-TPP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
RD-TPP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit
RD-TPP1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit
RD-TPP1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

TPP1 Rabbit pAb
A6269-100ul	Abclonal	100 ul	EUR 308

TPP1 Rabbit pAb
A6269-200ul	Abclonal	200 ul	EUR 459

TPP1 Rabbit pAb
A6269-20ul	Abclonal	20 ul	Ask for price

TPP1 Rabbit pAb
A6269-50ul	Abclonal	50 ul	Ask for price

TPP1 Rabbit pAb
A5627-100ul	Abclonal	100 ul	EUR 308

TPP1 Rabbit pAb
A5627-200ul	Abclonal	200 ul	EUR 459

TPP1 Rabbit pAb
A5627-20ul	Abclonal	20 ul	EUR 183

TPP1 Rabbit pAb
A5627-50ul	Abclonal	50 ul	EUR 223

TPP1 antibody
70R-13534	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal TPP1 antibody

TPP1 antibody
70R-20940	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal TPP1 antibody

TPP1 Antibody
32932-100ul	SAB	100ul	EUR 252

TPP1 Antibody
DF7425	Affbiotech	200ul	EUR 304
Description: TPP1 Antibody detects endogenous levels of total TPP1.

TPP1 Antibody
1-CSB-PA024113GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TPP1. Recognizes TPP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

TPP1 Antibody
1-CSB-PA024113LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TPP1. Recognizes TPP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

TPP1 Antibody
ABD7425	Lifescience Market	100 ug	EUR 438

Polyclonal TPP1 Antibody (N-term)
APR13781G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TPP1 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-CLN2 / TPP1 Antibody
APG03348G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-CLN2 / TPP1 . This antibody is tested and proven to work in the following applications:

TPP1 Conjugated Antibody
C32932	SAB	100ul	EUR 397

anti- TPP1 antibody
FNab08894	FN Test	100µg	EUR 548.75
Immunogen: tripeptidyl peptidase I Uniprot ID: O14773 Gene ID: 1200 Research Area: Neuroscience, Metabolism
Description: Antibody raised against TPP1

Anti-TPP1 antibody
PAab08894	Lifescience Market	100 ug	EUR 386

Anti-TPP1 Antibody
PB9899	BosterBio	100ug/vial	EUR 334

Anti-TPP1 antibody
STJ27594	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the sedolisin family of serine proteases. The protease functions in the lysosome to cleave N-terminal tripeptides from substrates, and has weaker endopeptidase activity. It is synthesized as a catalytically-inactive enzyme which is activated and auto-proteolyzed upon acidification. Mutations in this gene result in late-infantile neuronal ceroid lipofuscinosis, which is associated with the failure to degrade specific neuropeptides and a subunit of ATP synthase in the lysosome.

Anti-TPP1 antibody
STJ28191	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the sedolisin family of serine proteases. The protease functions in the lysosome to cleave N-terminal tripeptides from substrates, and has weaker endopeptidase activity. It is synthesized as a catalytically-inactive enzyme which is activated and auto-proteolyzed upon acidification. Mutations in this gene result in late-infantile neuronal ceroid lipofuscinosis, which is associated with the failure to degrade specific neuropeptides and a subunit of ATP synthase in the lysosome.

Anti-TPP1 antibody
STJ192438	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to TPP1

Tpp1/ Rat Tpp1 ELISA Kit
ELI-36485r	Lifescience Market	96 Tests	EUR 886

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human)
4-PAC828Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPP1 (Met1~Pro320) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1)

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse)
4-PAC828Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPP1 (Gly198~Pro562) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1)

TPP1 siRNA
20-abx905753	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TPP1 siRNA
20-abx937853	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TPP1 siRNA
20-abx937854	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-TPP1
YF-PA10990	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to TPP1

anti-TPP1
YF-PA10991	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to TPP1

anti-TPP1
YF-PA10992	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to TPP1

anti-TPP1
YF-PA10993	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to TPP1

TPP1 Antibody, HRP conjugated
1-CSB-PA024113LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TPP1. Recognizes TPP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TPP1 Antibody, FITC conjugated
1-CSB-PA024113LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TPP1. Recognizes TPP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TPP1 Antibody, Biotin conjugated
1-CSB-PA024113LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TPP1. Recognizes TPP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-CLN2 / TPP1 antibody
STJ72001	St John's Laboratory	100 µg	EUR 359

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), APC
4-PAC828Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPP1 (Met1~Pro320) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with APC.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), Biotinylated
4-PAC828Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPP1 (Met1~Pro320) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with Biotin.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), Cy3
4-PAC828Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPP1 (Met1~Pro320) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with Cy3.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), FITC
4-PAC828Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPP1 (Met1~Pro320) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with FITC.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), HRP
4-PAC828Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPP1 (Met1~Pro320) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with HRP.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), PE
4-PAC828Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPP1 (Met1~Pro320) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with PE.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), APC
4-PAC828Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPP1 (Gly198~Pro562) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with APC.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), Biotinylated
4-PAC828Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPP1 (Gly198~Pro562) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with Biotin.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), Cy3
4-PAC828Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPP1 (Gly198~Pro562) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with Cy3.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), FITC
4-PAC828Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPP1 (Gly198~Pro562) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with FITC.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), HRP
4-PAC828Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPP1 (Gly198~Pro562) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with HRP.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), PE
4-PAC828Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPP1 (Gly198~Pro562) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with PE.

Rabbit Tripeptidyl Peptidase I (TPP1) ELISA Kit
abx363635-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

TPP1 Blocking Peptide
DF7425-BP	Affbiotech	1mg	EUR 195

TPP1 cloning plasmid
CSB-CL024113HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1692 Sequence: atgggactccaagcctgcctcctagggctctttgccctcatcctctctggcaaatgcagttacagcccggagcccgaccagcggaggacgctgcccccaggctgggtgtccctgggccgtgcggaccctgaggaagagctgagtctcacctttgccctgagacagcagaatgtgg Show more
Description: A cloning plasmid for the TPP1 gene.

pCMV-SPORT6-TPP1
PVT13794	Lifescience Market	2 ug	EUR 391

Anti-TPP1 (3B1)
YF-MA10174	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TPP1

Tripeptidyl Peptidase I (TPP1) Antibody
20-abx004789	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Antibody
20-abx004302	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Antibody
20-abx178719	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Tripeptidyl Peptidase I (TPP1) Antibody
20-abx116291	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Antibody
20-abx129223	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Tripeptidyl Peptidase I (TPP1) Antibody
20-abx129835	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Tripeptidyl Peptidase I (TPP1) Antibody
abx145299-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Antibody
20-abx174934	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Tripeptidyl Peptidase I (TPP1) Antibody
abx029244-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Antibody
abx029244-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Antibody
abx238894-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Tripeptidyl Peptidase I (TPP1) Antibody
20-abx334373	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Human), APC-Cy7
4-PAC828Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPP1 (Met1~Pro320) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tripeptidyl Peptidase I (TPP1). This antibody is labeled with APC-Cy7.

Tripeptidyl Peptidase I (TPP1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC828Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TPP1 (Gly198~Pro562) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tripeptidyl Peptidase I (TPP1). This antibody is labeled with APC-Cy7.

Tripeptidyl Peptidase I (TPP1) Antibody (HRP)
20-abx338092	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Antibody (FITC)
20-abx338093	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tripeptidyl Peptidase I (TPP1) Antibody (Biotin)
20-abx338094	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

TPP1 ELISA KIT|Human
EF003763	Lifescience Market	96 Tests	EUR 689

Canine TPP1 ELISA KIT
ELI-51931d	Lifescience Market	96 Tests	EUR 928

Rat TPP1 shRNA Plasmid
20-abx986793	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse TPP1 shRNA Plasmid
20-abx969705	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human TPP1 shRNA Plasmid
20-abx950857	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TPP1 Recombinant Protein (Rat)
RP234425	ABM	100 ug	Ask for price

TPP1 Recombinant Protein (Human)
RP032686	ABM	100 ug	Ask for price

TPP1 Recombinant Protein (Mouse)
RP180740	ABM	100 ug	Ask for price

Monoclonal TPP1 Antibody (monoclonal) (M01), Clone: 3B1
APR13780G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human TPP1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3B1. This antibody is applicable in WB and IHC, E

Human TPP1 PicoKine ELISA Kit
EK2042	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human TPP1 in cell culture supernates, serum and plasma (heparin, EDTA).

Tpp1 ORF Vector (Rat) (pORF)
ORF078143	ABM	1.0 ug DNA	EUR 506

TPP1 ORF Vector (Human) (pORF)
ORF010896	ABM	1.0 ug DNA	EUR 95

Tpp1 ORF Vector (Mouse) (pORF)
ORF060248	ABM	1.0 ug DNA	EUR 506

Recombinant Tripeptidyl Peptidase I (TPP1)
4-RPC828Hu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O14773 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 38.2kDa Isoelectric Point: 5.7
Description: Recombinant Human Tripeptidyl Peptidase I expressed in: E.coli

Recombinant Tripeptidyl Peptidase I (TPP1)
4-RPC828Mu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O89023 Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 43.2kDa Isoelectric Point: 5.9
Description: Recombinant Mouse Tripeptidyl Peptidase I expressed in: E.coli

Monoclonal TPP1 / CLN2 Antibody (clone 3B1), Clone: 3B1
APR13779G	Leading Biology	0.05mg	EUR 528
Description: A Monoclonal antibody against Human TPP1 / CLN2 (clone 3B1). The antibodies are raised in Mouse and are from clone 3B1. This antibody is applicable in WB and IHC-P, E

Human Tripeptidyl Peptidase I (TPP1) Protein
20-abx166794	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Tripeptidyl Peptidase I (TPP1) Protein
20-abx167349	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Tpp1 sgRNA CRISPR Lentivector set (Rat)
K7023501	ABM	3 x 1.0 ug	EUR 339

Tpp1 sgRNA CRISPR Lentivector set (Mouse)
K3405201	ABM	3 x 1.0 ug	EUR 339

TPP1 sgRNA CRISPR Lentivector set (Human)
K2429301	ABM	3 x 1.0 ug	EUR 339

Human Tripeptidyl Peptidase I (TPP1)ELISA Kit
201-12-2521	SunredBio	96 tests	EUR 440
This Tripeptidyl Peptidase I ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

ELISA kit for Human TPP1 (Tripeptidyl Peptidase ?)
E-EL-H1479	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's TPP1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human TPP1. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human TPP1 (Tripeptidyl Peptidase ?) in samples from Serum, Plasma, Cell supernatant

Human Tripeptidyl-peptidase 1(TPP1) ELISA kit
CSB-EL024113HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tripeptidyl-peptidase 1 (TPP1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Tripeptidyl-peptidase 1(TPP1) ELISA kit
1-CSB-EL024113HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tripeptidyl-peptidase 1(TPP1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Tripeptidyl Peptidase I (TPP1) CLIA Kit
abx197847-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Mouse Tripeptidyl Peptidase I (TPP1) ELISA Kit
20-abx154796	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
20-abx153364	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Tripeptidyl- peptidase 1, TPP1 ELISA KIT
ELI-16982h	Lifescience Market	96 Tests	EUR 824

Pig Tripeptidyl Peptidase I (TPP1) ELISA Kit
abx360652-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
abx358322-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Monkey Tripeptidyl Peptidase I (TPP1) ELISA Kit
abx358877-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Tripeptidyl Peptidase I (TPP1) ELISA Kit
abx355837-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Sheep Tripeptidyl Peptidase I (TPP1) ELISA Kit
abx364262-96tests	Abbexa	96 tests	EUR 926
Shipped within 5-12 working days.

Human Tripeptidyl Peptidase I (TPP1) CLIA Kit
20-abx493920	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Tripeptidyl Peptidase I (TPP1) CLIA Kit
20-abx493921	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Bovine Tripeptidyl- peptidase 1, TPP1 ELISA KIT
ELI-40084b	Lifescience Market	96 Tests	EUR 928

Mouse Tripeptidyl- peptidase 1, Tpp1 ELISA KIT
ELI-40085m	Lifescience Market	96 Tests	EUR 865

Tpp1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7023502	ABM	1.0 ug DNA	EUR 154

Tpp1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7023503	ABM	1.0 ug DNA	EUR 154

Tpp1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7023504	ABM	1.0 ug DNA	EUR 154

Tpp1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3405202	ABM	1.0 ug DNA	EUR 154

Tpp1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3405203	ABM	1.0 ug DNA	EUR 154

Tpp1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3405204	ABM	1.0 ug DNA	EUR 154

TPP1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2429302	ABM	1.0 ug DNA	EUR 154

TPP1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2429303	ABM	1.0 ug DNA	EUR 154

TPP1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2429304	ABM	1.0 ug DNA	EUR 154

TPP1 Protein Vector (Rat) (pPB-C-His)
PV312570	ABM	500 ng	EUR 603

TPP1 Protein Vector (Rat) (pPB-N-His)
PV312571	ABM	500 ng	EUR 603

TPP1 Protein Vector (Rat) (pPM-C-HA)
PV312572	ABM	500 ng	EUR 603

TPP1 Protein Vector (Rat) (pPM-C-His)
PV312573	ABM	500 ng	EUR 603

TPP1 Protein Vector (Mouse) (pPB-C-His)
PV240990	ABM	500 ng	EUR 603

TPP1 Protein Vector (Mouse) (pPB-N-His)
PV240991	ABM	500 ng	EUR 603

TPP1 Protein Vector (Mouse) (pPM-C-HA)
PV240992	ABM	500 ng	EUR 603

TPP1 Protein Vector (Mouse) (pPM-C-His)
PV240993	ABM	500 ng	EUR 603

Human Tripeptidyl Peptidase I(TPP1)ELISA Kit
QY-E01705	Qayee Biotechnology	96T	EUR 361

Human Tripeptidyl Peptidase I ELISA Kit (TPP1)
RK02437	Abclonal	96 Tests	EUR 521

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
SEC828Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tripeptidyl Peptidase I (TPP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tripeptidyl Peptidase I (TPP1) in tissue homogenates, cell lysates and other biological fluids.

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
SEC828Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tripeptidyl Peptidase I (TPP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tripeptidyl Peptidase I (TPP1) in tissue homogenates, cell lysates and other biological fluids.

Human Tripeptidyl Peptidase I (TPP1) ELISA Kit
SEC828Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tripeptidyl Peptidase I (TPP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tripeptidyl Peptidase I (TPP1) in tissue homogenates, cell lysates and other biological fluids.

TPP1 Rabbit Polyclonal Antibody