셀타젠 Genetic Genotyping

TRIP6 Rabbit Polyclonal Antibody

TRIP6 Polyclonal Antibody

ES11401-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TRIP6 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Thyroid Hormone Receptor Interactor 6 (TRIP6) ELISA Kit

DLR-TRIP6-Hu-48T 48T
EUR 517
  • Should the Human Thyroid Hormone Receptor Interactor 6 (TRIP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thyroid Hormone Receptor Interactor 6 (TRIP6) in samples from tissue homogenates or other biological fluids.

Human Thyroid Hormone Receptor Interactor 6 (TRIP6) ELISA Kit

DLR-TRIP6-Hu-96T 96T
EUR 673
  • Should the Human Thyroid Hormone Receptor Interactor 6 (TRIP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thyroid Hormone Receptor Interactor 6 (TRIP6) in samples from tissue homogenates or other biological fluids.

Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6) ELISA Kit

DLR-TRIP6-Mu-48T 48T
EUR 527
  • Should the Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6) in samples from tissue homogenates or other biological fluids.

Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6) ELISA Kit

DLR-TRIP6-Mu-96T 96T
EUR 688
  • Should the Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6) in samples from tissue homogenates or other biological fluids.

Human Thyroid Hormone Receptor Interactor 6 (TRIP6) ELISA Kit

RDR-TRIP6-Hu-48Tests 48 Tests
EUR 544

Human Thyroid Hormone Receptor Interactor 6 (TRIP6) ELISA Kit

RDR-TRIP6-Hu-96Tests 96 Tests
EUR 756

Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6) ELISA Kit

RDR-TRIP6-Mu-48Tests 48 Tests
EUR 557

Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6) ELISA Kit

RDR-TRIP6-Mu-96Tests 96 Tests
EUR 774

Human Thyroid Hormone Receptor Interactor 6 (TRIP6) ELISA Kit

RD-TRIP6-Hu-48Tests 48 Tests
EUR 521

Human Thyroid Hormone Receptor Interactor 6 (TRIP6) ELISA Kit

RD-TRIP6-Hu-96Tests 96 Tests
EUR 723

Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6) ELISA Kit

RD-TRIP6-Mu-48Tests 48 Tests
EUR 533

Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6) ELISA Kit

RD-TRIP6-Mu-96Tests 96 Tests
EUR 740

TRIP6 Antibody

25199-100ul 100ul
EUR 390

TRIP6 antibody

70R-21002 50 ul
EUR 435
Description: Rabbit polyclonal TRIP6 antibody

TRIP6 Antibody

42789-100ul 100ul
EUR 252

TRIP6 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRIP6. Recognizes TRIP6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

TRIP6 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRIP6. Recognizes TRIP6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

TRIP6 antibody

70R-9086 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TRIP6 antibody

TRIP6 antibody

70R-9087 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TRIP6 antibody

TRIP6 Antibody

BF0021 200ul
EUR 376
Description: TRIP6 antibody detects endogenous levels of total TRIP6.

TRIP6 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TRIP6. Recognizes TRIP6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

Polyclonal TRIP6 Antibody (internal region)

AMM08342G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TRIP6 (internal region). This antibody is tested and proven to work in the following applications:

anti- TRIP6 antibody

FNab08999 100µg
EUR 548.75
  • Recommended dilution: WB: 1000-1:10000
  • IF: 1:10-1:100
  • Immunogen: thyroid hormone receptor interactor 6
  • Uniprot ID: Q15654
  • Gene ID: 7205
  • Research Area: Cell Division and Proliferation
Description: Antibody raised against TRIP6

anti- TRIP6 antibody

FNab09000 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200
  • FC:N/A
  • Immunogen: thyroid hormone receptor interactor 6
  • Uniprot ID: Q15654
  • Gene ID: 7205
  • Research Area: Cell Division and Proliferation
Description: Antibody raised against TRIP6

Anti-TRIP6 antibody

PAab08999 100 ug
EUR 386

Anti-TRIP6 antibody

STJ192559 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TRIP6

Anti-TRIP6 antibody

STJ72192 100 µg
EUR 359


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA15134 50 ul
EUR 363
Description: Mouse polyclonal to TRIP6


YF-PA15135 50 ug
EUR 363
Description: Mouse polyclonal to TRIP6


YF-PA15136 100 ug
EUR 403
Description: Rabbit polyclonal to TRIP6


YF-PA24897 50 ul
EUR 334
Description: Mouse polyclonal to TRIP6


YF-PA24898 50 ul
EUR 334
Description: Mouse polyclonal to TRIP6


YF-PA27391 100 ul
EUR 403
Description: Rabbit polyclonal to TRIP6

TRIP6 Blocking Peptide

33R-1536 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRIP6 antibody, catalog no. 70R-9087

TRIP6 Blocking Peptide

33R-6433 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRIP6 antibody, catalog no. 70R-9086

TRIP6 Blocking Peptide

BF0021-BP 1mg
EUR 195

TRIP6 cloning plasmid

CSB-CL620889HU1-10ug 10ug
EUR 510
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1431
  • Sequence: atgtcggggcccacctggctgcccccgaagcagccggagcccgccagagcccctcaggggagggcgatcccccgcggcaccccggggccaccaccggcccacggagcagcactccagccccaccccagggtcaatttttgcccccttccatctgagcagtgttaccaggccccag
  • Show more
Description: A cloning plasmid for the TRIP6 gene.

TRIP6 cloning plasmid

CSB-CL620889HU2-10ug 10ug
EUR 510
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1431
  • Sequence: atgtcggggcccacctggctgcccccgaagcagccggagcccgccagagcccctcaggggagggcgatcccccgcggcaccccggggccaccaccggcccacggagcagcactccagccccaccccagggtcaatttttgcccccttccatctgagcagtgttaccaggccccag
  • Show more
Description: A cloning plasmid for the TRIP6 gene.

TRIP6 cloning plasmid

CSB-CL620889HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1425
  • Sequence: atgtcggggcccacctggctgcccccgaagcagccggagcccgccagagcccctcaggggagggcgatcccccgcggcaccccggggccaccaccggcccacggagcagcactccaccccagggtcaatttttgcccccttccatctgagcagtgttaccaggccccagggggac
  • Show more
Description: A cloning plasmid for the TRIP6 gene.

Anti-TRIP6 (4B7)

YF-MA15941 100 ug
EUR 363
Description: Mouse monoclonal to TRIP6

Anti-TRIP6 (3D12)

YF-MA15942 100 ug
EUR 363
Description: Mouse monoclonal to TRIP6

Monoclonal TRIP6 Antibody, Clone: 6H4

AMM02918G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human TRIP6. The antibodies are raised in Mouse and are from clone 6H4. This antibody is applicable in WB, FC, E

Thyroid Hormone Receptor Interactor 6 (TRIP6) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRIP6 (Cys279~Cys476)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thyroid Hormone Receptor Interactor 6 (TRIP6)

Thyroid Hormone Receptor Interactor 6 (TRIP6) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRIP6 (Gly281~Glu471)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6)


EF003845 96 Tests
EUR 689

Mouse TRIP6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TRIP6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


PVT16254 2 ug
EUR 325

TRIP6 Recombinant Protein (Human)

RP033004 100 ug Ask for price

TRIP6 Recombinant Protein (Human)

RP033007 100 ug Ask for price

TRIP6 Recombinant Protein (Human)

RP033010 100 ug Ask for price

TRIP6 Recombinant Protein (Mouse)

RP181337 100 ug Ask for price

Thyroid Hormone Receptor Interactor 6 (TRIP6) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRIP6 (Cys279~Cys476)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thyroid Hormone Receptor Interactor 6 (TRIP6). This antibody is labeled with APC.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRIP6 (Cys279~Cys476)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thyroid Hormone Receptor Interactor 6 (TRIP6). This antibody is labeled with Biotin.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRIP6 (Cys279~Cys476)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thyroid Hormone Receptor Interactor 6 (TRIP6). This antibody is labeled with Cy3.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRIP6 (Cys279~Cys476)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thyroid Hormone Receptor Interactor 6 (TRIP6). This antibody is labeled with FITC.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRIP6 (Cys279~Cys476)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thyroid Hormone Receptor Interactor 6 (TRIP6). This antibody is labeled with HRP.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRIP6 (Cys279~Cys476)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thyroid Hormone Receptor Interactor 6 (TRIP6). This antibody is labeled with PE.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRIP6 (Gly281~Glu471)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6). This antibody is labeled with APC.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRIP6 (Gly281~Glu471)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6). This antibody is labeled with Biotin.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRIP6 (Gly281~Glu471)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6). This antibody is labeled with Cy3.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRIP6 (Gly281~Glu471)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6). This antibody is labeled with FITC.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRIP6 (Gly281~Glu471)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6). This antibody is labeled with HRP.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRIP6 (Gly281~Glu471)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6). This antibody is labeled with PE.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRIP6 (Cys279~Cys476)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thyroid Hormone Receptor Interactor 6 (TRIP6). This antibody is labeled with APC-Cy7.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TRIP6 (Gly281~Glu471)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6). This antibody is labeled with APC-Cy7.

Monoclonal TRIP6 Antibody (monoclonal) (M04), Clone: 4B7

AMM08343G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human TRIP6 (monoclonal) (M04). The antibodies are raised in mouse and are from clone 4B7. This antibody is applicable in WB and IF, E

Thyroid Receptor-Interacting Protein 6 (TRIP6) Antibody

abx027873-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Thyroid Receptor-Interacting Protein 6 (TRIP6) Antibody

abx027873-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Thyroid Receptor-Interacting Protein 6 (TRIP6) Antibody

abx012184-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Thyroid Receptor-Interacting Protein 6 (TRIP6) Antibody

abx238999-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Thyroid Receptor-Interacting Protein 6 (TRIP6) Antibody

abx239000-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Thyroid Receptor-Interacting Protein 6 (TRIP6) Antibody

abx433411-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

TRIP6 ORF Vector (Human) (pORF)

ORF011002 1.0 ug DNA
EUR 95

TRIP6 ORF Vector (Human) (pORF)

ORF011003 1.0 ug DNA
EUR 95

TRIP6 ORF Vector (Human) (pORF)

ORF011004 1.0 ug DNA
EUR 95

Trip6 ORF Vector (Mouse) (pORF)

ORF060447 1.0 ug DNA
EUR 506

TRIP6 ELISA Kit (Mouse) (OKCD01015)

OKCD01015 96 Wells
EUR 857
Description: Description of target: Relays signals from the cell surface to the nucleus to weaken adherens junction and promote actin cytoskeleton reorganization and cell invasiveness. Involved in lysophosphatidic acid-induced cell adhesion and migration. Acts as a transcriptional coactivator for NF-kappa-B and JUN, and mediates the transrepression of these transcription factors induced by glucocorticoid receptor (By similarity).By similarity ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.144 ng/mL

Trip6 sgRNA CRISPR Lentivector set (Mouse)

K4483701 3 x 1.0 ug
EUR 339

TRIP6 sgRNA CRISPR Lentivector set (Human)

K2470401 3 x 1.0 ug
EUR 339

Trip6 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4483702 1.0 ug DNA
EUR 154

Trip6 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4483703 1.0 ug DNA
EUR 154

Trip6 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4483704 1.0 ug DNA
EUR 154

TRIP6 sgRNA CRISPR Lentivector (Human) (Target 1)

K2470402 1.0 ug DNA
EUR 154

TRIP6 sgRNA CRISPR Lentivector (Human) (Target 2)

K2470403 1.0 ug DNA
EUR 154

TRIP6 sgRNA CRISPR Lentivector (Human) (Target 3)

K2470404 1.0 ug DNA
EUR 154

TRIP6 Protein Vector (Mouse) (pPB-C-His)

PV241786 500 ng
EUR 603

TRIP6 Protein Vector (Mouse) (pPB-N-His)

PV241787 500 ng
EUR 603

TRIP6 Protein Vector (Mouse) (pPM-C-HA)

PV241788 500 ng
EUR 603

TRIP6 Protein Vector (Mouse) (pPM-C-His)

PV241789 500 ng
EUR 603

Recombinant Thyroid Hormone Receptor Interactor 6 (TRIP6)

  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q15654
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 51.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Thyroid Hormone Receptor Interactor 6 expressed in: E.coli

Recombinant Thyroid Hormone Receptor Interactor 6 (TRIP6)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9Z1Y4
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 50.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Thyroid Hormone Receptor Interactor 6 expressed in: E.coli

TRIP6 Protein Vector (Human) (pPB-C-His)

PV044005 500 ng
EUR 329

TRIP6 Protein Vector (Human) (pPB-N-His)

PV044006 500 ng
EUR 329

TRIP6 Protein Vector (Human) (pPM-C-HA)

PV044007 500 ng
EUR 329

TRIP6 Protein Vector (Human) (pPM-C-His)

PV044008 500 ng
EUR 329

TRIP6 Protein Vector (Human) (pPB-C-His)

PV044009 500 ng
EUR 329

TRIP6 Protein Vector (Human) (pPB-N-His)

PV044010 500 ng
EUR 329

TRIP6 Protein Vector (Human) (pPM-C-HA)

PV044011 500 ng
EUR 329

TRIP6 Protein Vector (Human) (pPM-C-His)

PV044012 500 ng
EUR 329

TRIP6 Protein Vector (Human) (pPB-C-His)

PV044013 500 ng
EUR 329

TRIP6 Protein Vector (Human) (pPB-N-His)

PV044014 500 ng
EUR 329

TRIP6 Protein Vector (Human) (pPM-C-HA)

PV044015 500 ng
EUR 329

TRIP6 Protein Vector (Human) (pPM-C-His)

PV044016 500 ng
EUR 329

Trip6 3'UTR Luciferase Stable Cell Line

TU121148 1.0 ml Ask for price

Trip6 3'UTR GFP Stable Cell Line

TU171148 1.0 ml Ask for price

TRIP6 3'UTR GFP Stable Cell Line

TU076612 1.0 ml
EUR 1394

TRIP6 3'UTR Luciferase Stable Cell Line

TU026612 1.0 ml
EUR 1394

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

TRIP6 Rabbit Polyclonal Antibody