TRIP6 Rabbit Polyclonal Antibody

TRIP6 Polyclonal Antibody
ABP60761-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human TRIP6 protein at amino acid sequence of 221-270 Applications tips:
Description: A polyclonal antibody for detection of TRIP6 from Human. This TRIP6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRIP6 protein at amino acid sequence of 221-270

Human Thyroid Hormone Receptor Interactor 6 (TRIP6) ELISA Kit
DLR-TRIP6-Hu-48T	DL Develop	48T	EUR 517
Should the Human Thyroid Hormone Receptor Interactor 6 (TRIP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thyroid Hormone Receptor Interactor 6 (TRIP6) in samples from tissue homogenates or other biological fluids.

Human Thyroid Hormone Receptor Interactor 6 (TRIP6) ELISA Kit
DLR-TRIP6-Hu-96T	DL Develop	96T	EUR 673
Should the Human Thyroid Hormone Receptor Interactor 6 (TRIP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thyroid Hormone Receptor Interactor 6 (TRIP6) in samples from tissue homogenates or other biological fluids.

Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6) ELISA Kit
DLR-TRIP6-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6) in samples from tissue homogenates or other biological fluids.

Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6) ELISA Kit
DLR-TRIP6-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6) in samples from tissue homogenates or other biological fluids.

Human Thyroid Hormone Receptor Interactor 6 (TRIP6) ELISA Kit
RDR-TRIP6-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Thyroid Hormone Receptor Interactor 6 (TRIP6) ELISA Kit
RDR-TRIP6-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6) ELISA Kit
RDR-TRIP6-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6) ELISA Kit
RDR-TRIP6-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Human Thyroid Hormone Receptor Interactor 6 (TRIP6) ELISA Kit
RD-TRIP6-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Thyroid Hormone Receptor Interactor 6 (TRIP6) ELISA Kit
RD-TRIP6-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6) ELISA Kit
RD-TRIP6-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6) ELISA Kit
RD-TRIP6-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

TRIP6 Antibody
BF0021	Affbiotech	200ul	EUR 376
Description: TRIP6 antibody detects endogenous levels of total TRIP6.

TRIP6 antibody
70R-21002	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal TRIP6 antibody

TRIP6 antibody
70R-9086	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal TRIP6 antibody

TRIP6 antibody
70R-9087	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal TRIP6 antibody

TRIP6 Antibody
42789-100ul	SAB	100ul	EUR 252

TRIP6 Antibody
25199-100ul	SAB	100ul	EUR 390

TRIP6 Antibody
1-CSB-PA439253	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRIP6. Recognizes TRIP6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

TRIP6 Antibody
1-CSB-PA112642	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRIP6. Recognizes TRIP6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

TRIP6 Antibody
1-CSB-PA024528GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TRIP6. Recognizes TRIP6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

Polyclonal TRIP6 Antibody (internal region)
AMM08342G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TRIP6 (internal region). This antibody is tested and proven to work in the following applications:

anti- TRIP6 antibody
FNab08999	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1000-1:10000 IF: 1:10-1:100 Immunogen: thyroid hormone receptor interactor 6 Uniprot ID: Q15654 Gene ID: 7205 Research Area: Cell Division and Proliferation
Description: Antibody raised against TRIP6

anti- TRIP6 antibody
FNab09000	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:5000 IHC: 1:20-1:200 FC:N/A Immunogen: thyroid hormone receptor interactor 6 Uniprot ID: Q15654 Gene ID: 7205 Research Area: Cell Division and Proliferation
Description: Antibody raised against TRIP6

Anti-TRIP6 antibody
PAab08999	Lifescience Market	100 ug	EUR 386

Anti-TRIP6 antibody
STJ72192	St John's Laboratory	100 µg	EUR 359

Anti-TRIP6 antibody
STJ192559	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to TRIP6

TRIP6 siRNA
20-abx938152	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TRIP6 siRNA
20-abx938153	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-TRIP6
YF-PA15134	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to TRIP6

anti-TRIP6
YF-PA15135	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to TRIP6

anti-TRIP6
YF-PA15136	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to TRIP6

anti-TRIP6
YF-PA27391	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to TRIP6

anti-TRIP6
YF-PA24897	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to TRIP6

anti-TRIP6
YF-PA24898	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to TRIP6

TRIP6 Blocking Peptide
BF0021-BP	Affbiotech	1mg	EUR 195

TRIP6 Blocking Peptide
33R-6433	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRIP6 antibody, catalog no. 70R-9086

TRIP6 Blocking Peptide
33R-1536	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRIP6 antibody, catalog no. 70R-9087

TRIP6 cloning plasmid
CSB-CL620889HU1-10ug	Cusabio	10ug	EUR 510
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1431 Sequence: atgtcggggcccacctggctgcccccgaagcagccggagcccgccagagcccctcaggggagggcgatcccccgcggcaccccggggccaccaccggcccacggagcagcactccagccccaccccagggtcaatttttgcccccttccatctgagcagtgttaccaggccccag Show more
Description: A cloning plasmid for the TRIP6 gene.

TRIP6 cloning plasmid
CSB-CL620889HU2-10ug	Cusabio	10ug	EUR 510
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1431 Sequence: atgtcggggcccacctggctgcccccgaagcagccggagcccgccagagcccctcaggggagggcgatcccccgcggcaccccggggccaccaccggcccacggagcagcactccagccccaccccagggtcaatttttgcccccttccatctgagcagtgttaccaggccccag Show more
Description: A cloning plasmid for the TRIP6 gene.

TRIP6 cloning plasmid
CSB-CL620889HU3-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1425 Sequence: atgtcggggcccacctggctgcccccgaagcagccggagcccgccagagcccctcaggggagggcgatcccccgcggcaccccggggccaccaccggcccacggagcagcactccaccccagggtcaatttttgcccccttccatctgagcagtgttaccaggccccagggggac Show more
Description: A cloning plasmid for the TRIP6 gene.

Anti-TRIP6 (4B7)
YF-MA15941	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TRIP6

Anti-TRIP6 (3D12)
YF-MA15942	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TRIP6

Monoclonal TRIP6 Antibody, Clone: 6H4
AMM02918G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human TRIP6. The antibodies are raised in Mouse and are from clone 6H4. This antibody is applicable in WB, FC, E

Thyroid Hormone Receptor Interactor 6 (TRIP6) Polyclonal Antibody (Human)
4-PAH002Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TRIP6 (Cys279~Cys476) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thyroid Hormone Receptor Interactor 6 (TRIP6)

Thyroid Hormone Receptor Interactor 6 (TRIP6) Polyclonal Antibody (Mouse)
4-PAH002Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TRIP6 (Gly281~Glu471) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6)

TRIP6 ELISA KIT|Human
EF003845	Lifescience Market	96 Tests	EUR 689

Human TRIP6 shRNA Plasmid
20-abx954943	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse TRIP6 shRNA Plasmid
20-abx973220	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TRIP6 Recombinant Protein (Human)
RP033004	ABM	100 ug	Ask for price

TRIP6 Recombinant Protein (Human)
RP033007	ABM	100 ug	Ask for price

TRIP6 Recombinant Protein (Human)
RP033010	ABM	100 ug	Ask for price

TRIP6 Recombinant Protein (Mouse)
RP181337	ABM	100 ug	Ask for price

pCMV-SPORT6-TRIP6 Plasmid
PVT16254	Lifescience Market	2 ug	EUR 325

Thyroid Hormone Receptor Interactor 6 (TRIP6) Polyclonal Antibody (Human), APC
4-PAH002Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TRIP6 (Cys279~Cys476) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thyroid Hormone Receptor Interactor 6 (TRIP6). This antibody is labeled with APC.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Polyclonal Antibody (Human), Biotinylated
4-PAH002Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TRIP6 (Cys279~Cys476) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thyroid Hormone Receptor Interactor 6 (TRIP6). This antibody is labeled with Biotin.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Polyclonal Antibody (Human), Cy3
4-PAH002Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TRIP6 (Cys279~Cys476) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thyroid Hormone Receptor Interactor 6 (TRIP6). This antibody is labeled with Cy3.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Polyclonal Antibody (Human), FITC
4-PAH002Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TRIP6 (Cys279~Cys476) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thyroid Hormone Receptor Interactor 6 (TRIP6). This antibody is labeled with FITC.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Polyclonal Antibody (Human), HRP
4-PAH002Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TRIP6 (Cys279~Cys476) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thyroid Hormone Receptor Interactor 6 (TRIP6). This antibody is labeled with HRP.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Polyclonal Antibody (Human), PE
4-PAH002Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TRIP6 (Cys279~Cys476) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thyroid Hormone Receptor Interactor 6 (TRIP6). This antibody is labeled with PE.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Polyclonal Antibody (Mouse), APC
4-PAH002Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TRIP6 (Gly281~Glu471) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6). This antibody is labeled with APC.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Polyclonal Antibody (Mouse), Biotinylated
4-PAH002Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TRIP6 (Gly281~Glu471) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6). This antibody is labeled with Biotin.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Polyclonal Antibody (Mouse), Cy3
4-PAH002Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TRIP6 (Gly281~Glu471) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6). This antibody is labeled with Cy3.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Polyclonal Antibody (Mouse), FITC
4-PAH002Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TRIP6 (Gly281~Glu471) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6). This antibody is labeled with FITC.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Polyclonal Antibody (Mouse), HRP
4-PAH002Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TRIP6 (Gly281~Glu471) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6). This antibody is labeled with HRP.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Polyclonal Antibody (Mouse), PE
4-PAH002Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TRIP6 (Gly281~Glu471) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6). This antibody is labeled with PE.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Polyclonal Antibody (Human), APC-Cy7
4-PAH002Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TRIP6 (Cys279~Cys476) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thyroid Hormone Receptor Interactor 6 (TRIP6). This antibody is labeled with APC-Cy7.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Polyclonal Antibody (Mouse), APC-Cy7
4-PAH002Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TRIP6 (Gly281~Glu471) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Thyroid Hormone Receptor Interactor 6 (TRIP6). This antibody is labeled with APC-Cy7.

Monoclonal TRIP6 Antibody (monoclonal) (M04), Clone: 4B7
AMM08343G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human TRIP6 (monoclonal) (M04). The antibodies are raised in mouse and are from clone 4B7. This antibody is applicable in WB and IF, E

Thyroid Hormone Receptor Interactor 6 (TRIP6) Antibody
20-abx116096	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Antibody
20-abx131404	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Antibody
20-abx131405	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Thyroid Receptor-Interacting Protein 6 (TRIP6) Antibody
abx012184-100ug	Abbexa	100 ug	EUR 411
Shipped within 5-10 working days.

Thyroid Receptor-Interacting Protein 6 (TRIP6) Antibody
abx027873-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Thyroid Receptor-Interacting Protein 6 (TRIP6) Antibody
abx027873-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Thyroid Receptor-Interacting Protein 6 (TRIP6) Antibody
abx433411-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Thyroid Receptor-Interacting Protein 6 (TRIP6) Antibody
abx238999-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Thyroid Receptor-Interacting Protein 6 (TRIP6) Antibody
abx239000-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Antibody
20-abx178587	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Antibody
20-abx212433	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Thyroid Hormone Receptor Interactor 6 (TRIP6) Antibody
20-abx212434	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

TRIP6 ORF Vector (Human) (pORF)
ORF011002	ABM	1.0 ug DNA	EUR 95

TRIP6 ORF Vector (Human) (pORF)
ORF011003	ABM	1.0 ug DNA	EUR 95

TRIP6 ORF Vector (Human) (pORF)
ORF011004	ABM	1.0 ug DNA	EUR 95

Trip6 ORF Vector (Mouse) (pORF)
ORF060447	ABM	1.0 ug DNA	EUR 506

TRIP6 ELISA Kit (Mouse) (OKCD01015)
OKCD01015	Aviva Systems Biology	96 Wells	EUR 857
Description: Description of target: Relays signals from the cell surface to the nucleus to weaken adherens junction and promote actin cytoskeleton reorganization and cell invasiveness. Involved in lysophosphatidic acid-induced cell adhesion and migration. Acts as a transcriptional coactivator for NF-kappa-B and JUN, and mediates the transrepression of these transcription factors induced by glucocorticoid receptor (By similarity).By similarity ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.144 ng/mL

TRIP6 sgRNA CRISPR Lentivector set (Human)
K2470401	ABM	3 x 1.0 ug	EUR 339

Trip6 sgRNA CRISPR Lentivector set (Mouse)
K4483701	ABM	3 x 1.0 ug	EUR 339

TRIP6 sgRNA CRISPR Lentivector (Human) (Target 1)
K2470402	ABM	1.0 ug DNA	EUR 154

TRIP6 sgRNA CRISPR Lentivector (Human) (Target 2)
K2470403	ABM	1.0 ug DNA	EUR 154

TRIP6 sgRNA CRISPR Lentivector (Human) (Target 3)
K2470404	ABM	1.0 ug DNA	EUR 154

Trip6 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4483702	ABM	1.0 ug DNA	EUR 154

Trip6 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4483703	ABM	1.0 ug DNA	EUR 154

Trip6 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4483704	ABM	1.0 ug DNA	EUR 154

TRIP6 Protein Vector (Human) (pPB-C-His)
PV044005	ABM	500 ng	EUR 329

TRIP6 Protein Vector (Human) (pPB-N-His)
PV044006	ABM	500 ng	EUR 329

TRIP6 Protein Vector (Human) (pPM-C-HA)
PV044007	ABM	500 ng	EUR 329

TRIP6 Protein Vector (Human) (pPM-C-His)
PV044008	ABM	500 ng	EUR 329

TRIP6 Protein Vector (Human) (pPB-C-His)
PV044009	ABM	500 ng	EUR 329

TRIP6 Protein Vector (Human) (pPB-N-His)
PV044010	ABM	500 ng	EUR 329

TRIP6 Protein Vector (Human) (pPM-C-HA)
PV044011	ABM	500 ng	EUR 329

TRIP6 Protein Vector (Human) (pPM-C-His)
PV044012	ABM	500 ng	EUR 329

TRIP6 Protein Vector (Human) (pPB-C-His)
PV044013	ABM	500 ng	EUR 329

TRIP6 Protein Vector (Human) (pPB-N-His)
PV044014	ABM	500 ng	EUR 329

TRIP6 Protein Vector (Human) (pPM-C-HA)
PV044015	ABM	500 ng	EUR 329

TRIP6 Protein Vector (Human) (pPM-C-His)
PV044016	ABM	500 ng	EUR 329

Recombinant Thyroid Hormone Receptor Interactor 6 (TRIP6)
4-RPH002Hu01	Cloud-Clone	EUR 458.40 EUR 226.00 EUR 1444.00 EUR 548.00 EUR 996.00 EUR 370.00 EUR 3460.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q15654 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 51.5kDa Isoelectric Point: Inquire
Description: Recombinant Human Thyroid Hormone Receptor Interactor 6 expressed in: E.coli

Recombinant Thyroid Hormone Receptor Interactor 6 (TRIP6)
4-RPH002Mu01	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9Z1Y4 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 50.9kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Thyroid Hormone Receptor Interactor 6 expressed in: E.coli

TRIP6 Protein Vector (Mouse) (pPB-C-His)
PV241786	ABM	500 ng	EUR 603

TRIP6 Protein Vector (Mouse) (pPB-N-His)
PV241787	ABM	500 ng	EUR 603

TRIP6 Protein Vector (Mouse) (pPM-C-HA)
PV241788	ABM	500 ng	EUR 603

TRIP6 Protein Vector (Mouse) (pPM-C-His)
PV241789	ABM	500 ng	EUR 603

Trip6 3'UTR GFP Stable Cell Line
TU171148	ABM	1.0 ml	Ask for price

TRIP6 3'UTR GFP Stable Cell Line
TU076612	ABM	1.0 ml	EUR 1394

Trip6 3'UTR Luciferase Stable Cell Line
TU121148	ABM	1.0 ml	Ask for price

TRIP6 3'UTR Luciferase Stable Cell Line
TU026612	ABM	1.0 ml	EUR 1394

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

TRIP6 Rabbit Polyclonal Antibody