CelltaGen
셀타젠 Genetic Genotyping

UPK3A Rabbit Polyclonal Antibody

UPK3A Polyclonal Antibody

ES11396-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against UPK3A from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Uroplakin 3A (UPK3A) ELISA Kit

DLR-UPK3A-Hu-48T 48T
EUR 517
  • Should the Human Uroplakin 3A (UPK3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Uroplakin 3A (UPK3A) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Uroplakin 3A (UPK3A) ELISA Kit

DLR-UPK3A-Hu-96T 96T
EUR 673
  • Should the Human Uroplakin 3A (UPK3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Uroplakin 3A (UPK3A) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Uroplakin 3A (UPK3A) ELISA Kit

RDR-UPK3A-Hu-48Tests 48 Tests
EUR 544

Human Uroplakin 3A (UPK3A) ELISA Kit

RDR-UPK3A-Hu-96Tests 96 Tests
EUR 756

Human Uroplakin 3A (UPK3A) ELISA Kit

RD-UPK3A-Hu-48Tests 48 Tests
EUR 521

Human Uroplakin 3A (UPK3A) ELISA Kit

RD-UPK3A-Hu-96Tests 96 Tests
EUR 723

UPK3A Rabbit pAb

A10034-100ul 100 ul
EUR 308

UPK3A Rabbit pAb

A10034-200ul 200 ul
EUR 459

UPK3A Rabbit pAb

A10034-20ul 20 ul
EUR 183

UPK3A Rabbit pAb

A10034-50ul 50 ul
EUR 223

UPK3A Antibody

43619-100ul 100ul
EUR 252

UPK3A Antibody

1-CSB-PA025657ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against UPK3A. Recognizes UPK3A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

UPK3A Antibody

1-CSB-PA025657ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against UPK3A. Recognizes UPK3A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNUB0409-100 100uL
EUR 209
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), Concentration: 0.2mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNUB0409-500 500uL
EUR 458
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), Concentration: 0.2mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNUM0409-50 50uL
EUR 395
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), 1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNC040409-100 100uL
EUR 199
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF405S conjugate, Concentration: 0.1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNC040409-500 500uL
EUR 544
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF405S conjugate, Concentration: 0.1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNC610409-100 100uL
EUR 199
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF660R conjugate, Concentration: 0.1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNC610409-500 500uL
EUR 544
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF660R conjugate, Concentration: 0.1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNC470409-100 100uL
EUR 199
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF647 conjugate, Concentration: 0.1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNC470409-500 500uL
EUR 544
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF647 conjugate, Concentration: 0.1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNC550409-100 100uL
EUR 199
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF555 conjugate, Concentration: 0.1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNC550409-500 500uL
EUR 544
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF555 conjugate, Concentration: 0.1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNC050409-100 100uL
EUR 199
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF405M conjugate, Concentration: 0.1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNC050409-500 500uL
EUR 544
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF405M conjugate, Concentration: 0.1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNC400409-100 100uL
EUR 199
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF640R conjugate, Concentration: 0.1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNC400409-500 500uL
EUR 544
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF640R conjugate, Concentration: 0.1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNC430409-100 100uL
EUR 199
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF543 conjugate, Concentration: 0.1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNC430409-500 500uL
EUR 544
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF543 conjugate, Concentration: 0.1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNC800409-100 100uL
EUR 199
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF680 conjugate, Concentration: 0.1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNC800409-500 500uL
EUR 544
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF680 conjugate, Concentration: 0.1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNC810409-100 100uL
EUR 199
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF680R conjugate, Concentration: 0.1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNC810409-500 500uL
EUR 544
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF680R conjugate, Concentration: 0.1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNCP0409-250 250uL
EUR 383
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), PerCP conjugate, Concentration: 0.1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNCR0409-250 250uL
EUR 383
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), RPE conjugate, Concentration: 0.1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNCA0409-250 250uL
EUR 383
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), APC conjugate, Concentration: 0.1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNCAP0409-100 100uL
EUR 199
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNCAP0409-500 500uL
EUR 544
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNCH0409-100 100uL
EUR 199
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNCH0409-500 500uL
EUR 544
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNC940409-100 100uL
EUR 199
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF594 conjugate, Concentration: 0.1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNC940409-500 500uL
EUR 544
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF594 conjugate, Concentration: 0.1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNC700409-100 100uL
EUR 199
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF770 conjugate, Concentration: 0.1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNC700409-500 500uL
EUR 544
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF770 conjugate, Concentration: 0.1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNCB0409-100 100uL
EUR 199
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), Biotin conjugate, Concentration: 0.1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNCB0409-500 500uL
EUR 544
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), Biotin conjugate, Concentration: 0.1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNC880409-100 100uL
EUR 199
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF488A conjugate, Concentration: 0.1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNC880409-500 500uL
EUR 544
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF488A conjugate, Concentration: 0.1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNC680409-100 100uL
EUR 199
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF568 conjugate, Concentration: 0.1mg/mL

UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody

BNC680409-500 500uL
EUR 544
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF568 conjugate, Concentration: 0.1mg/mL

Rabbit Anti-mouse UPK3A (UPK3A- phosphor) IgG (aff pure)

AB-23006-A 100 ug
EUR 482

UPK3A Conjugated Antibody

C43619 100ul
EUR 397

Anti-UPK3A antibody

STJ112074 100 µl
EUR 277
Description: This gene encodes a member of the uroplakin family, a group of transmembrane proteins that form complexes on the apical surface of the bladder epithelium. Mutations in this gene may be associated with renal adysplasia. Alternatively spliced transcript variants have been described.

Anti-UPK3A antibody

STJ192554 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to UPK3A

Rabbit Anti-mouse uroplakin 3A (UPK3A) (UPK3A- phosphor) IgG (aff pure)

AB-23008-A 100ug
EUR 482

Uroplakin 3A (UPK3A) Polyclonal Antibody (Human, Rat)

4-PAF558Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK3A (Phe15~Ile211)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Uroplakin 3A (UPK3A)

Uroplakin 3A (UPK3A) Polyclonal Antibody (Human, Rat)

4-PAF558Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK3A (Cys15~Thr212)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Uroplakin 3A (UPK3A)

UPK3A siRNA

20-abx939076
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UPK3A siRNA

20-abx939077
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Uroplakin 3A (UPK3A) Antibody

20-abx128350
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Uroplakin 3A (UPK3A) Antibody

20-abx130100
  • EUR 328.00
  • EUR 133.00
  • EUR 871.00
  • EUR 453.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Uroplakin 3A (UPK3A) Antibody

20-abx135952
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Uroplakin 3A (UPK3A) Antibody

20-abx175044
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Uroplakin 3A (UPK3A) Antibody

20-abx175045
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Uroplakin 3A (UPK3A) Antibody

20-abx321145
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Uroplakin 3A (UPK3A) Antibody

20-abx322620
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rabbit Anti-African clawed frog uroplakin 3A (UPK3A) (UPK3A- phosphor) IgG (aff pure)

AB-23007-A 100ug
EUR 482

Uroplakin 3A (UPK3A) Polyclonal Antibody (Human, Rat), APC

4-PAF558Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK3A (Phe15~Ile211)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Uroplakin 3A (UPK3A). This antibody is labeled with APC.

Uroplakin 3A (UPK3A) Polyclonal Antibody (Human, Rat), Biotinylated

4-PAF558Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK3A (Phe15~Ile211)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Uroplakin 3A (UPK3A). This antibody is labeled with Biotin.

Uroplakin 3A (UPK3A) Polyclonal Antibody (Human, Rat), Cy3

4-PAF558Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK3A (Phe15~Ile211)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Uroplakin 3A (UPK3A). This antibody is labeled with Cy3.

Uroplakin 3A (UPK3A) Polyclonal Antibody (Human, Rat), FITC

4-PAF558Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK3A (Phe15~Ile211)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Uroplakin 3A (UPK3A). This antibody is labeled with FITC.

Uroplakin 3A (UPK3A) Polyclonal Antibody (Human, Rat), HRP

4-PAF558Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK3A (Phe15~Ile211)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Uroplakin 3A (UPK3A). This antibody is labeled with HRP.

Uroplakin 3A (UPK3A) Polyclonal Antibody (Human, Rat), PE

4-PAF558Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK3A (Phe15~Ile211)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Uroplakin 3A (UPK3A). This antibody is labeled with PE.

Uroplakin 3A (UPK3A) Polyclonal Antibody (Human, Rat), APC

4-PAF558Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK3A (Cys15~Thr212)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Uroplakin 3A (UPK3A). This antibody is labeled with APC.

Uroplakin 3A (UPK3A) Polyclonal Antibody (Human, Rat), Biotinylated

4-PAF558Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK3A (Cys15~Thr212)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Uroplakin 3A (UPK3A). This antibody is labeled with Biotin.

Uroplakin 3A (UPK3A) Polyclonal Antibody (Human, Rat), Cy3

4-PAF558Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK3A (Cys15~Thr212)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Uroplakin 3A (UPK3A). This antibody is labeled with Cy3.

Uroplakin 3A (UPK3A) Polyclonal Antibody (Human, Rat), FITC

4-PAF558Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK3A (Cys15~Thr212)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Uroplakin 3A (UPK3A). This antibody is labeled with FITC.

Uroplakin 3A (UPK3A) Polyclonal Antibody (Human, Rat), HRP

4-PAF558Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK3A (Cys15~Thr212)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Uroplakin 3A (UPK3A). This antibody is labeled with HRP.

Uroplakin 3A (UPK3A) Polyclonal Antibody (Human, Rat), PE

4-PAF558Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK3A (Cys15~Thr212)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Uroplakin 3A (UPK3A). This antibody is labeled with PE.

Mouse uroplakin 3A (UPK3A) control (UPK3A- phosphor) peptide

AB-23006-P 100ug
EUR 164

Mouse uroplakin 3A (UPK3A) control (UPK3A- phosphor) peptide

AB-23008-P 100ug
EUR 164

UPK3A, human recombinant

7188-10
EUR 305

UPK3A, human recombinant

7188-50
EUR 827

UPK3A cloning plasmid

CSB-CL025657HU-10ug 10ug
EUR 352
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 864
  • Sequence: atgcctccgctctgggccctgctggccctcggctgcctgcggttcggctcggctgtgaacctgcagccccaactggccagtgtgactttcgccaccaacaaccccacacttaccactgtggccttggaaaagcctctctgcatgtttgacagcaaagaggccctcactggcaccca
  • Show more
Description: A cloning plasmid for the UPK3A gene.

Recombinant mouse UPK3A

P1945 100ug Ask for price
  • Uniprot ID: Q9JKX8
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for mouse UPK3A

Uroplakin 3A (UPK3A) Polyclonal Antibody (Human, Rat), APC-Cy7

4-PAF558Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK3A (Phe15~Ile211)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Uroplakin 3A (UPK3A). This antibody is labeled with APC-Cy7.

Uroplakin 3A (UPK3A) Polyclonal Antibody (Human, Rat), APC-Cy7

4-PAF558Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK3A (Cys15~Thr212)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Uroplakin 3A (UPK3A). This antibody is labeled with APC-Cy7.

African clawed frog uroplakin 3A (UPK3A) control (UPK3A- phosphor) peptide

AB-23007-P 100ug
EUR 164

Mouse Uroplakin-3a (Upk3a)

1-CSB-EP862403MO
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 25.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Uroplakin-3a(Upk3a),partial expressed in E.coli

UPK3A protein (His tag)

80R-2046 50 ug
EUR 424
Description: Recombinant human UPK3A protein (His tag)

Mouse UPK3A shRNA Plasmid

20-abx973326
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human UPK3A shRNA Plasmid

20-abx955049
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

UPK3A Recombinant Protein (Rat)

RP235940 100 ug Ask for price

Recombinant Uroplakin 3A (UPK3A)

4-RPF558Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O75631
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 24.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Uroplakin 3A expressed in: E.coli

Recombinant Uroplakin 3A (UPK3A)

4-RPF558Ra01
  • EUR 510.37
  • EUR 239.00
  • EUR 1638.88
  • EUR 612.96
  • EUR 1125.92
  • EUR 404.00
  • EUR 3947.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: D3ZZ76
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 25.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Uroplakin 3A expressed in: E.coli

UPK3A Recombinant Protein (Human)

RP034000 100 ug Ask for price

UPK3A Recombinant Protein (Mouse)

RP183209 100 ug Ask for price

Rabbit Anti- mouse uroplakin 3A (UPK3A) IgG (aff pure)

AB-23012-A 100 ug
EUR 482

Rat Uroplakin 3A (UPK3A) Protein

20-abx167686
  • EUR 718.00
  • EUR 286.00
  • EUR 2207.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Uroplakin 3A (UPK3A) Protein

20-abx168151
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Upk3a ORF Vector (Mouse) (pORF)

ORF061071 1.0 ug DNA
EUR 506

Upk3a ORF Vector (Rat) (pORF)

ORF078648 1.0 ug DNA
EUR 506

UPK3A ORF Vector (Human) (pORF)

ORF011334 1.0 ug DNA
EUR 95

Human Uroplakin 3A (UPK3A) ELISA Kit

20-abx153447
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Uroplakin 3A (UPK3A) ELISA Kit

20-abx258070
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Bovine Uroplakin- 3a, UPK3A ELISA KIT

ELI-16722b 96 Tests
EUR 928

Mouse Uroplakin- 3a, Upk3a ELISA KIT

ELI-16917m 96 Tests
EUR 865

Human Uroplakin- 3a, UPK3A ELISA KIT

ELI-28840h 96 Tests
EUR 824

Human Uroplakin 3A (UPK3A) CLIA Kit

20-abx494949
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Uroplakin 3A (UPK3A) CLIA Kit

20-abx494950
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Upk3a sgRNA CRISPR Lentivector set (Rat)

K6692701 3 x 1.0 ug
EUR 339

UPK3A sgRNA CRISPR Lentivector set (Human)

K2592001 3 x 1.0 ug
EUR 339

Upk3a sgRNA CRISPR Lentivector set (Mouse)

K4009701 3 x 1.0 ug
EUR 339

UPK3A Uroplakin 3A Human Recombinant Protein

PROTO75631 Regular: 10ug
EUR 317
Description: UPK3A Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 214 amino acids (19-207 a.a.) and having a molecular mass of 23.1kDa.;UPK3A is fused to a 25 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Human Uroplakin 3A(UPK3A)ELISA Kit

QY-E02050 96T
EUR 374

Human Uroplakin 3A ELISA Kit (UPK3A)

RK02482 96 Tests
EUR 521

Human Uroplakin 3A (UPK3A) ELISA Kit

SEF558Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 3A (UPK3A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 3A (UPK3A) in serum, plasma, tissue homogenates and other biological fluids.

Human Uroplakin 3A (UPK3A) ELISA Kit

SEF558Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 3A (UPK3A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 3A (UPK3A) in serum, plasma, tissue homogenates and other biological fluids.

Human Uroplakin 3A (UPK3A) ELISA Kit

SEF558Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 3A (UPK3A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 3A (UPK3A) in serum, plasma, tissue homogenates and other biological fluids.

Human Uroplakin 3A (UPK3A) ELISA Kit

SEF558Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 3A (UPK3A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 3A (UPK3A) in serum, plasma, tissue homogenates and other biological fluids.

Human Uroplakin 3A (UPK3A) ELISA Kit

4-SEF558Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Uroplakin 3A elisa. Alternative names of the recognized antigen: UPIII
  • UPK3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Uroplakin 3A (UPK3A) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Uroplakin 3A (UPK3A) ELISA Kit

SEF558Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uroplakin 3A (UPK3A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uroplakin 3A (UPK3A) in serum, plasma, tissue homogenates and other biological fluids.

Rat Uroplakin 3A (UPK3A) ELISA Kit

SEF558Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uroplakin 3A (UPK3A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uroplakin 3A (UPK3A) in serum, plasma, tissue homogenates and other biological fluids.

Rat Uroplakin 3A (UPK3A) ELISA Kit

SEF558Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uroplakin 3A (UPK3A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uroplakin 3A (UPK3A) in serum, plasma, tissue homogenates and other biological fluids.

Rat Uroplakin 3A (UPK3A) ELISA Kit

SEF558Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uroplakin 3A (UPK3A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uroplakin 3A (UPK3A) in serum, plasma, tissue homogenates and other biological fluids.

Rat Uroplakin 3A (UPK3A) ELISA Kit

4-SEF558Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Uroplakin 3A elisa. Alternative names of the recognized antigen: UPIII
  • UPK3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Uroplakin 3A (UPK3A) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human UPK3A (Uroplakin 3A)

ELK3941 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Uroplakin 3A (UPK3A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Uroplakin 3A
  • Show more
Description: A sandwich ELISA kit for detection of Uroplakin 3A from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse uroplakin 3A (UPK3A) Control/blocking peptide

AB-23012-P 100ug
EUR 164

ELISA kit for Rat UPK3A (Uroplakin 3A)

ELK7360 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Uroplakin 3A (UPK3A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Uroplakin 3A
  • Show more
Description: A sandwich ELISA kit for detection of Uroplakin 3A from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Upk3a sgRNA CRISPR Lentivector (Rat) (Target 1)

K6692702 1.0 ug DNA
EUR 154

UPK3A Rabbit Polyclonal Antibody