UPK3A Rabbit Polyclonal Antibody
UPK3A Polyclonal Antibody |
ES11396-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against UPK3A from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Human Uroplakin 3A (UPK3A) ELISA Kit |
DLR-UPK3A-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Uroplakin 3A (UPK3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Uroplakin 3A (UPK3A) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Uroplakin 3A (UPK3A) ELISA Kit |
DLR-UPK3A-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Uroplakin 3A (UPK3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Uroplakin 3A (UPK3A) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Uroplakin 3A (UPK3A) ELISA Kit |
RDR-UPK3A-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Uroplakin 3A (UPK3A) ELISA Kit |
RDR-UPK3A-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Uroplakin 3A (UPK3A) ELISA Kit |
RD-UPK3A-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Uroplakin 3A (UPK3A) ELISA Kit |
RD-UPK3A-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
UPK3A Rabbit pAb |
A10034-100ul |
Abclonal |
100 ul |
EUR 308 |
UPK3A Rabbit pAb |
A10034-200ul |
Abclonal |
200 ul |
EUR 459 |
UPK3A Rabbit pAb |
A10034-20ul |
Abclonal |
20 ul |
EUR 183 |
UPK3A Rabbit pAb |
A10034-50ul |
Abclonal |
50 ul |
EUR 223 |
UPK3A Antibody |
43619-100ul |
SAB |
100ul |
EUR 252 |
UPK3A Antibody |
1-CSB-PA025657ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against UPK3A. Recognizes UPK3A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000 |
UPK3A Antibody |
1-CSB-PA025657ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against UPK3A. Recognizes UPK3A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNUB0409-100 |
Biotium |
100uL |
EUR 209 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), Concentration: 0.2mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNUB0409-500 |
Biotium |
500uL |
EUR 458 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), Concentration: 0.2mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNUM0409-50 |
Biotium |
50uL |
EUR 395 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), 1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNC040409-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF405S conjugate, Concentration: 0.1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNC040409-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF405S conjugate, Concentration: 0.1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNC610409-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF660R conjugate, Concentration: 0.1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNC610409-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF660R conjugate, Concentration: 0.1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNC470409-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF647 conjugate, Concentration: 0.1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNC470409-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF647 conjugate, Concentration: 0.1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNC550409-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF555 conjugate, Concentration: 0.1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNC550409-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF555 conjugate, Concentration: 0.1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNC050409-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF405M conjugate, Concentration: 0.1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNC050409-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF405M conjugate, Concentration: 0.1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNC400409-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF640R conjugate, Concentration: 0.1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNC400409-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF640R conjugate, Concentration: 0.1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNC430409-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF543 conjugate, Concentration: 0.1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNC430409-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF543 conjugate, Concentration: 0.1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNC800409-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF680 conjugate, Concentration: 0.1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNC800409-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF680 conjugate, Concentration: 0.1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNC810409-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF680R conjugate, Concentration: 0.1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNC810409-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF680R conjugate, Concentration: 0.1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNCP0409-250 |
Biotium |
250uL |
EUR 383 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), PerCP conjugate, Concentration: 0.1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNCR0409-250 |
Biotium |
250uL |
EUR 383 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), RPE conjugate, Concentration: 0.1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNCA0409-250 |
Biotium |
250uL |
EUR 383 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), APC conjugate, Concentration: 0.1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNCAP0409-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNCAP0409-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNCH0409-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNCH0409-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNC940409-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF594 conjugate, Concentration: 0.1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNC940409-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF594 conjugate, Concentration: 0.1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNC700409-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF770 conjugate, Concentration: 0.1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNC700409-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF770 conjugate, Concentration: 0.1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNCB0409-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), Biotin conjugate, Concentration: 0.1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNCB0409-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), Biotin conjugate, Concentration: 0.1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNC880409-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF488A conjugate, Concentration: 0.1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNC880409-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF488A conjugate, Concentration: 0.1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNC680409-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF568 conjugate, Concentration: 0.1mg/mL |
UPK3A (Uroplakin 3A)(Rabbit PAb) Antibody |
BNC680409-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against UPK3A (Uroplakin 3A)(Rabbit PAb), CF568 conjugate, Concentration: 0.1mg/mL |
Rabbit Anti-mouse UPK3A (UPK3A- phosphor) IgG (aff pure) |
AB-23006-A |
Alpha Diagnostics |
100 ug |
EUR 482 |
UPK3A Conjugated Antibody |
C43619 |
SAB |
100ul |
EUR 397 |
Anti-UPK3A antibody |
STJ112074 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the uroplakin family, a group of transmembrane proteins that form complexes on the apical surface of the bladder epithelium. Mutations in this gene may be associated with renal adysplasia. Alternatively spliced transcript variants have been described. |
Anti-UPK3A antibody |
STJ192554 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to UPK3A |
Rabbit Anti-mouse uroplakin 3A (UPK3A) (UPK3A- phosphor) IgG (aff pure) |
AB-23008-A |
Alpha Diagnostics |
100ug |
EUR 482 |
Uroplakin 3A (UPK3A) Polyclonal Antibody (Human, Rat) |
4-PAF558Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UPK3A (Phe15~Ile211)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Uroplakin 3A (UPK3A) |
Uroplakin 3A (UPK3A) Polyclonal Antibody (Human, Rat) |
4-PAF558Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UPK3A (Cys15~Thr212)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Uroplakin 3A (UPK3A) |
UPK3A siRNA |
20-abx939076 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
UPK3A siRNA |
20-abx939077 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Uroplakin 3A (UPK3A) Antibody |
20-abx128350 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Uroplakin 3A (UPK3A) Antibody |
20-abx130100 |
Abbexa |
-
EUR 328.00
-
EUR 133.00
-
EUR 871.00
-
EUR 453.00
-
EUR 272.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Uroplakin 3A (UPK3A) Antibody |
20-abx135952 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Uroplakin 3A (UPK3A) Antibody |
20-abx175044 |
Abbexa |
|
|
|
Uroplakin 3A (UPK3A) Antibody |
20-abx175045 |
Abbexa |
|
|
|
Uroplakin 3A (UPK3A) Antibody |
20-abx321145 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Uroplakin 3A (UPK3A) Antibody |
20-abx322620 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Rabbit Anti-African clawed frog uroplakin 3A (UPK3A) (UPK3A- phosphor) IgG (aff pure) |
AB-23007-A |
Alpha Diagnostics |
100ug |
EUR 482 |
Uroplakin 3A (UPK3A) Polyclonal Antibody (Human, Rat), APC |
4-PAF558Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UPK3A (Phe15~Ile211)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Uroplakin 3A (UPK3A). This antibody is labeled with APC. |
Uroplakin 3A (UPK3A) Polyclonal Antibody (Human, Rat), Biotinylated |
4-PAF558Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UPK3A (Phe15~Ile211)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Uroplakin 3A (UPK3A). This antibody is labeled with Biotin. |
Uroplakin 3A (UPK3A) Polyclonal Antibody (Human, Rat), Cy3 |
4-PAF558Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UPK3A (Phe15~Ile211)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Uroplakin 3A (UPK3A). This antibody is labeled with Cy3. |
Uroplakin 3A (UPK3A) Polyclonal Antibody (Human, Rat), FITC |
4-PAF558Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UPK3A (Phe15~Ile211)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Uroplakin 3A (UPK3A). This antibody is labeled with FITC. |
Uroplakin 3A (UPK3A) Polyclonal Antibody (Human, Rat), HRP |
4-PAF558Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UPK3A (Phe15~Ile211)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Uroplakin 3A (UPK3A). This antibody is labeled with HRP. |
Uroplakin 3A (UPK3A) Polyclonal Antibody (Human, Rat), PE |
4-PAF558Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UPK3A (Phe15~Ile211)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Uroplakin 3A (UPK3A). This antibody is labeled with PE. |
Uroplakin 3A (UPK3A) Polyclonal Antibody (Human, Rat), APC |
4-PAF558Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UPK3A (Cys15~Thr212)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Uroplakin 3A (UPK3A). This antibody is labeled with APC. |
Uroplakin 3A (UPK3A) Polyclonal Antibody (Human, Rat), Biotinylated |
4-PAF558Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UPK3A (Cys15~Thr212)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Uroplakin 3A (UPK3A). This antibody is labeled with Biotin. |
Uroplakin 3A (UPK3A) Polyclonal Antibody (Human, Rat), Cy3 |
4-PAF558Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UPK3A (Cys15~Thr212)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Uroplakin 3A (UPK3A). This antibody is labeled with Cy3. |
Uroplakin 3A (UPK3A) Polyclonal Antibody (Human, Rat), FITC |
4-PAF558Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UPK3A (Cys15~Thr212)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Uroplakin 3A (UPK3A). This antibody is labeled with FITC. |
Uroplakin 3A (UPK3A) Polyclonal Antibody (Human, Rat), HRP |
4-PAF558Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UPK3A (Cys15~Thr212)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Uroplakin 3A (UPK3A). This antibody is labeled with HRP. |
Uroplakin 3A (UPK3A) Polyclonal Antibody (Human, Rat), PE |
4-PAF558Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UPK3A (Cys15~Thr212)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Uroplakin 3A (UPK3A). This antibody is labeled with PE. |
Mouse uroplakin 3A (UPK3A) control (UPK3A- phosphor) peptide |
AB-23006-P |
Alpha Diagnostics |
100ug |
EUR 164 |
Mouse uroplakin 3A (UPK3A) control (UPK3A- phosphor) peptide |
AB-23008-P |
Alpha Diagnostics |
100ug |
EUR 164 |
UPK3A, human recombinant |
7188-10 |
Biovision |
|
EUR 305 |
UPK3A, human recombinant |
7188-50 |
Biovision |
|
EUR 827 |
UPK3A cloning plasmid |
CSB-CL025657HU-10ug |
Cusabio |
10ug |
EUR 352 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 864
- Sequence: atgcctccgctctgggccctgctggccctcggctgcctgcggttcggctcggctgtgaacctgcagccccaactggccagtgtgactttcgccaccaacaaccccacacttaccactgtggccttggaaaagcctctctgcatgtttgacagcaaagaggccctcactggcaccca
- Show more
|
Description: A cloning plasmid for the UPK3A gene. |
Recombinant mouse UPK3A |
P1945 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: Q9JKX8
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for mouse UPK3A |
Uroplakin 3A (UPK3A) Polyclonal Antibody (Human, Rat), APC-Cy7 |
4-PAF558Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UPK3A (Phe15~Ile211)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Uroplakin 3A (UPK3A). This antibody is labeled with APC-Cy7. |
Uroplakin 3A (UPK3A) Polyclonal Antibody (Human, Rat), APC-Cy7 |
4-PAF558Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UPK3A (Cys15~Thr212)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Uroplakin 3A (UPK3A). This antibody is labeled with APC-Cy7. |
African clawed frog uroplakin 3A (UPK3A) control (UPK3A- phosphor) peptide |
AB-23007-P |
Alpha Diagnostics |
100ug |
EUR 164 |
Mouse Uroplakin-3a (Upk3a) |
1-CSB-EP862403MO |
Cusabio |
-
EUR 611.00
-
EUR 309.00
-
EUR 1827.00
-
EUR 939.00
-
EUR 1218.00
-
EUR 397.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 25.5 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Uroplakin-3a(Upk3a),partial expressed in E.coli |
UPK3A protein (His tag) |
80R-2046 |
Fitzgerald |
50 ug |
EUR 424 |
Description: Recombinant human UPK3A protein (His tag) |
Mouse UPK3A shRNA Plasmid |
20-abx973326 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human UPK3A shRNA Plasmid |
20-abx955049 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
UPK3A Recombinant Protein (Rat) |
RP235940 |
ABM |
100 ug |
Ask for price |
Recombinant Uroplakin 3A (UPK3A) |
4-RPF558Hu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O75631
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 24.9kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Uroplakin 3A expressed in: E.coli |
Recombinant Uroplakin 3A (UPK3A) |
4-RPF558Ra01 |
Cloud-Clone |
-
EUR 510.37
-
EUR 239.00
-
EUR 1638.88
-
EUR 612.96
-
EUR 1125.92
-
EUR 404.00
-
EUR 3947.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: D3ZZ76
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 25.1kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Rat Uroplakin 3A expressed in: E.coli |
UPK3A Recombinant Protein (Human) |
RP034000 |
ABM |
100 ug |
Ask for price |
UPK3A Recombinant Protein (Mouse) |
RP183209 |
ABM |
100 ug |
Ask for price |
Rabbit Anti- mouse uroplakin 3A (UPK3A) IgG (aff pure) |
AB-23012-A |
Alpha Diagnostics |
100 ug |
EUR 482 |
Rat Uroplakin 3A (UPK3A) Protein |
20-abx167686 |
Abbexa |
-
EUR 718.00
-
EUR 286.00
-
EUR 2207.00
-
EUR 843.00
-
EUR 509.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Uroplakin 3A (UPK3A) Protein |
20-abx168151 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Upk3a ORF Vector (Mouse) (pORF) |
ORF061071 |
ABM |
1.0 ug DNA |
EUR 506 |
Upk3a ORF Vector (Rat) (pORF) |
ORF078648 |
ABM |
1.0 ug DNA |
EUR 506 |
UPK3A ORF Vector (Human) (pORF) |
ORF011334 |
ABM |
1.0 ug DNA |
EUR 95 |
UPK3A ELISA Kit (Human) (OKCD00978) |
OKCD00978 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Component of the asymmetric unit membrane (AUM); a highly specialized biomembrane elaborated by terminally differentiated urothelial cells. May play an important role in AUM-cytoskeleton interaction in terminally differentiated urothelial cells. It also contributes to the formation of urothelial glycocalyx which may play an important role in preventing bacterial adherence (By similarity).By similarity ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.125 ng/mL |
UPK3A ELISA Kit (Rat) (OKCD00203) |
OKCD00203 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 6.5 pg/mL |
Human Uroplakin 3A (UPK3A) ELISA Kit |
20-abx153447 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Uroplakin 3A (UPK3A) ELISA Kit |
20-abx258070 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Uroplakin 3A (UPK3A) CLIA Kit |
20-abx494949 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Rat Uroplakin 3A (UPK3A) CLIA Kit |
20-abx494950 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Upk3a sgRNA CRISPR Lentivector set (Rat) |
K6692701 |
ABM |
3 x 1.0 ug |
EUR 339 |
UPK3A sgRNA CRISPR Lentivector set (Human) |
K2592001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Upk3a sgRNA CRISPR Lentivector set (Mouse) |
K4009701 |
ABM |
3 x 1.0 ug |
EUR 339 |
UPK3A Uroplakin 3A Human Recombinant Protein |
PROTO75631 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: UPK3A Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 214 amino acids (19-207 a.a.) and having a molecular mass of 23.1kDa.;UPK3A is fused to a 25 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Human Uroplakin 3A ELISA Kit (UPK3A) |
RK02482 |
Abclonal |
96 Tests |
EUR 521 |
Human Uroplakin 3A (UPK3A) ELISA Kit |
SEF558Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 3A (UPK3A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 3A (UPK3A) in serum, plasma, tissue homogenates and other biological fluids. |
Human Uroplakin 3A (UPK3A) ELISA Kit |
SEF558Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 3A (UPK3A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 3A (UPK3A) in serum, plasma, tissue homogenates and other biological fluids. |
Human Uroplakin 3A (UPK3A) ELISA Kit |
SEF558Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 3A (UPK3A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 3A (UPK3A) in serum, plasma, tissue homogenates and other biological fluids. |
Human Uroplakin 3A (UPK3A) ELISA Kit |
SEF558Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 3A (UPK3A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 3A (UPK3A) in serum, plasma, tissue homogenates and other biological fluids. |
Human Uroplakin 3A (UPK3A) ELISA Kit |
4-SEF558Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Uroplakin 3A elisa. Alternative names of the recognized antigen: UPIII
- UPK3
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Uroplakin 3A (UPK3A) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Rat Uroplakin 3A (UPK3A) ELISA Kit |
SEF558Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uroplakin 3A (UPK3A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uroplakin 3A (UPK3A) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Uroplakin 3A (UPK3A) ELISA Kit |
SEF558Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uroplakin 3A (UPK3A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uroplakin 3A (UPK3A) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Uroplakin 3A (UPK3A) ELISA Kit |
SEF558Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uroplakin 3A (UPK3A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uroplakin 3A (UPK3A) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Uroplakin 3A (UPK3A) ELISA Kit |
SEF558Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uroplakin 3A (UPK3A) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uroplakin 3A (UPK3A) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Uroplakin 3A (UPK3A) ELISA Kit |
4-SEF558Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Uroplakin 3A elisa. Alternative names of the recognized antigen: UPIII
- UPK3
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Uroplakin 3A (UPK3A) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
ELISA kit for Human UPK3A (Uroplakin 3A) |
ELK3941 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Uroplakin 3A (UPK3A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Uroplakin 3A
- Show more
|
Description: A sandwich ELISA kit for detection of Uroplakin 3A from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Mouse uroplakin 3A (UPK3A) Control/blocking peptide |
AB-23012-P |
Alpha Diagnostics |
100ug |
EUR 164 |
UPK3A Rabbit Polyclonal Antibody