VAMP1 Rabbit Polyclonal Antibody
VAMP1 Polyclonal Antibody |
ABP60868-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human VAMP1 protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of VAMP1 from Human, Mouse, Rat. This VAMP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VAMP1 protein at amino acid sequence of 30-110 |
VAMP1 Polyclonal Antibody |
ABP60868-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human VAMP1 protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of VAMP1 from Human, Mouse, Rat. This VAMP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VAMP1 protein at amino acid sequence of 30-110 |
VAMP1 Polyclonal Antibody |
ABP60868-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human VAMP1 protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of VAMP1 from Human, Mouse, Rat. This VAMP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VAMP1 protein at amino acid sequence of 30-110 |
VAMP1 Polyclonal Antibody |
A63776 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
VAMP1 Rabbit pAb |
A8877-100ul |
Abclonal |
100 ul |
EUR 308 |
VAMP1 Rabbit pAb |
A8877-200ul |
Abclonal |
200 ul |
EUR 459 |
VAMP1 Rabbit pAb |
A8877-20ul |
Abclonal |
20 ul |
EUR 183 |
VAMP1 Rabbit pAb |
A8877-50ul |
Abclonal |
50 ul |
EUR 223 |
VAMP1 antibody |
70R-21229 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal VAMP1 antibody |
Vamp1 antibody |
70R-9793 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal Vamp1 antibody |
Vamp1 antibody |
70R-9794 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal Vamp1 antibody |
VAMP1 Antibody |
49966-100ul |
SAB |
100ul |
EUR 333 |
VAMP1 Antibody |
49966-50ul |
SAB |
50ul |
EUR 239 |
VAMP1 Antibody |
40289-100ul |
SAB |
100ul |
EUR 252 |
VAMP1 Antibody |
1-CSB-PA240065 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against VAMP1. Recognizes VAMP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100 |
VAMP1 Antibody |
1-CSB-PA188240 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against VAMP1. Recognizes VAMP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:20-1:100 |
VAMP1 Antibody |
1-CSB-PA025780GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against VAMP1. Recognizes VAMP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
VAMP1 Antibody |
1-CSB-PA025780LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against VAMP1. Recognizes VAMP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Polyclonal Vamp1 antibody - middle region |
APR13934G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Vamp1 - middle region. This antibody is tested and proven to work in the following applications: |
VAMP1 Polyclonal Antibody, HRP Conjugated |
A63777 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
VAMP1 Polyclonal Antibody, FITC Conjugated |
A63778 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
VAMP1 Polyclonal Antibody, Biotin Conjugated |
A63779 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
VAMP1 Conjugated Antibody |
C40289 |
SAB |
100ul |
EUR 397 |
VAMP1 Conjugated Antibody |
C49966 |
SAB |
100ul |
EUR 397 |
anti- VAMP1 antibody |
FNab09358 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:5000
- IF: 1:20-1:200
- Immunogen: vesicle-associated membrane protein 1(synaptobrevin 1)
- Uniprot ID: P23763
- Gene ID: 6843
- Research Area: Neuroscience, Developmental biology
|
Description: Antibody raised against VAMP1 |
VAMP1/2 antibody |
10R-8383 |
Fitzgerald |
100 ul |
EUR 392 |
Description: Mouse monoclonal VAMP1/2 antibody |
Human VAMP1 Antibody |
32869-05111 |
AssayPro |
150 ug |
EUR 261 |
Anti-VAMP1 antibody |
STJ111459 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Synapotobrevins, syntaxins, and the synaptosomal-associated protein SNAP25 are the main components of a protein complex involved in the docking and/or fusion of synaptic vesicles with the presynaptic membrane. The protein encoded by this gene is a member of the vesicle-associated membrane protein (VAMP)/synaptobrevin family. Mutations in this gene are associated with autosomal dominant spastic ataxia 1. Multiple alternative splice variants have been described, but the full-length nature of some variants has not been defined. |
Anti-VAMP1 antibody |
STJ192365 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to VAMP1 |
VAMP1 siRNA |
20-abx905998 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VAMP1 siRNA |
20-abx939310 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VAMP1 siRNA |
20-abx939311 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VAMP1 / VAMP2 / VAMP3 Antibody |
20-abx326473 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VAMP1/VAMP2/VAMP3 Antibody |
1-CSB-PA050186 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against VAMP1/VAMP2/VAMP3. Recognizes VAMP1/VAMP2/VAMP3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000 |
VAMP1 Antibody, HRP conjugated |
1-CSB-PA025780LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against VAMP1. Recognizes VAMP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
VAMP1 Antibody, FITC conjugated |
1-CSB-PA025780LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against VAMP1. Recognizes VAMP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
VAMP1 Antibody, Biotin conjugated |
1-CSB-PA025780LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against VAMP1. Recognizes VAMP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
VAMP1 cloning plasmid |
CSB-CL025780HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 354
- Sequence: atgtctgctccagctcagccacctgctgaagggacagaagggactgccccaggtgggggtccccctggccctcctcctaacatgaccagtaacagacgactacagcaaacccaggcacaagtggaggaggtggtggacatcatacgtgtgaacgtggacaaggtcctggagaggga
- Show more
|
Description: A cloning plasmid for the VAMP1 gene. |
Vamp1 Blocking Peptide |
33R-2033 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Vamp1 antibody, catalog no. 70R-9793 |
Vamp1 Blocking Peptide |
33R-2531 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Vamp1 antibody, catalog no. 70R-9794 |
anti-VAMP1 (5F3) |
LF-MA10378 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to VAMP1 |
Anti-VAMP1 (5A4) |
YF-MA10897 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to VAMP1 |
Human VAMP1 Antibody (Biotin Conjugate) |
32869-05121 |
AssayPro |
150 ug |
EUR 369 |
Anti-VAMP1/2 Monoclonal Antibody |
M05982 |
BosterBio |
100ug |
EUR 397 |
Description: Mouse Monoclonal VAMP1/2 Antibody. Validated in ELISA, IHC, WB and tested in Human, Rat. |
Monoclonal antibody for VAMP1/2 |
SMC-179C |
Stressmarq |
0.025mg |
EUR 170 |
- VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
- Show more
|
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is not conjugated. |
Monoclonal antibody for VAMP1/2 |
SMC-179D |
Stressmarq |
0.1mg |
EUR 302 |
- VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
- Show more
|
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is not conjugated. |
Monoclonal antibody for VAMP1/2 |
SMC-179D-A390 |
Stressmarq |
0.1mg |
EUR 349 |
- VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
- Show more
|
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with ATTO 390. |
Monoclonal antibody for VAMP1/2 |
SMC-179D-A488 |
Stressmarq |
0.1mg |
EUR 348 |
- VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
- Show more
|
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with ATTO 488. |
Monoclonal antibody for VAMP1/2 |
SMC-179D-A565 |
Stressmarq |
0.1mg |
EUR 348 |
- VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
- Show more
|
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with ATTO 565. |
Monoclonal antibody for VAMP1/2 |
SMC-179D-A594 |
Stressmarq |
0.1mg |
EUR 348 |
- VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
- Show more
|
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with ATTO 594. |
Monoclonal antibody for VAMP1/2 |
SMC-179D-A633 |
Stressmarq |
0.1mg |
EUR 348 |
- VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
- Show more
|
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with ATTO 633. |
Monoclonal antibody for VAMP1/2 |
SMC-179D-A655 |
Stressmarq |
0.1mg |
EUR 348 |
- VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
- Show more
|
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with ATTO 655. |
Monoclonal antibody for VAMP1/2 |
SMC-179D-A680 |
Stressmarq |
0.1mg |
EUR 348 |
- VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
- Show more
|
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with ATTO 680. |
Monoclonal antibody for VAMP1/2 |
SMC-179D-A700 |
Stressmarq |
0.1mg |
EUR 348 |
- VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
- Show more
|
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with ATTO 700. |
Monoclonal antibody for VAMP1/2 |
SMC-179D-ALP |
Stressmarq |
0.1mg |
EUR 342 |
- VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
- Show more
|
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with Alkaline Phosphatase. |
Monoclonal antibody for VAMP1/2 |
SMC-179D-APC |
Stressmarq |
0.1mg |
EUR 347 |
- VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
- Show more
|
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with APC. |
Monoclonal antibody for VAMP1/2 |
SMC-179D-APCCY7 |
Stressmarq |
0.1mg |
EUR 419 |
- VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
- Show more
|
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with APC/Cy7. |
Monoclonal antibody for VAMP1/2 |
SMC-179D-BI |
Stressmarq |
0.1mg |
EUR 344 |
- VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
- Show more
|
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with Biotin. |
Monoclonal antibody for VAMP1/2 |
SMC-179D-DY350 |
Stressmarq |
0.1mg |
EUR 362 |
- VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
- Show more
|
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with Dylight 350. |
Monoclonal antibody for VAMP1/2 |
SMC-179D-DY405 |
Stressmarq |
0.1mg |
EUR 351 |
- VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
- Show more
|
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with Dylight 405. |
Monoclonal antibody for VAMP1/2 |
SMC-179D-DY488 |
Stressmarq |
0.1mg |
EUR 341 |
- VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
- Show more
|
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with Dylight 488. |
Monoclonal antibody for VAMP1/2 |
SMC-179D-DY594 |
Stressmarq |
0.1mg |
EUR 343 |
- VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
- Show more
|
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with Dylight 594. |
Monoclonal antibody for VAMP1/2 |
SMC-179D-DY633 |
Stressmarq |
0.1mg |
EUR 338 |
- VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
- Show more
|
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with Dylight 633. |
Monoclonal antibody for VAMP1/2 |
SMC-179D-FITC |
Stressmarq |
0.1mg |
EUR 340 |
- VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
- Show more
|
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with FITC. |
Monoclonal antibody for VAMP1/2 |
SMC-179D-HRP |
Stressmarq |
0.1mg |
EUR 336 |
- VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
- Show more
|
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with HRP. |
Monoclonal antibody for VAMP1/2 |
SMC-179D-P594 |
Stressmarq |
0.1mg |
EUR 355 |
- VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
- Show more
|
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with PE/ATTO 594. |
Monoclonal antibody for VAMP1/2 |
SMC-179D-PCP |
Stressmarq |
0.1mg |
EUR 347 |
- VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
- Show more
|
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with PerCP. |
Monoclonal antibody for VAMP1/2 |
SMC-179D-RPE |
Stressmarq |
0.1mg |
EUR 345 |
- VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
- Show more
|
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat | Pig VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with RPE. |
Monoclonal antibody for VAMP1/2 |
SMC-179D-STR |
Stressmarq |
0.1mg |
EUR 346 |
- VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
- Show more
|
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat | Pig VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with Streptavidin. |
Monoclonal antibody for VAMP1/2 |
SMC-179S |
Stressmarq |
0.012mg |
EUR 65 |
- VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1)
- Show more
|
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat | Pig VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is not conjugated. |
VAMP1 Rabbit Polyclonal Antibody