VAMP1 Rabbit Polyclonal Antibody

VAMP1 Rabbit Polyclonal Antibody

VAMP1 Polyclonal Antibody
ABP60868-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human VAMP1 protein at amino acid sequence of 30-110 Applications tips:
Description: A polyclonal antibody for detection of VAMP1 from Human, Mouse, Rat. This VAMP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VAMP1 protein at amino acid sequence of 30-110

VAMP1 Polyclonal Antibody
ABP60868-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human VAMP1 protein at amino acid sequence of 30-110 Applications tips:
Description: A polyclonal antibody for detection of VAMP1 from Human, Mouse, Rat. This VAMP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VAMP1 protein at amino acid sequence of 30-110

VAMP1 Polyclonal Antibody
ABP60868-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human VAMP1 protein at amino acid sequence of 30-110 Applications tips:
Description: A polyclonal antibody for detection of VAMP1 from Human, Mouse, Rat. This VAMP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VAMP1 protein at amino acid sequence of 30-110

VAMP1 Polyclonal Antibody
A63776	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

VAMP1 Rabbit pAb
A8877-100ul	Abclonal	100 ul	EUR 308

VAMP1 Rabbit pAb
A8877-200ul	Abclonal	200 ul	EUR 459

VAMP1 Rabbit pAb
A8877-20ul	Abclonal	20 ul	EUR 183

VAMP1 Rabbit pAb
A8877-50ul	Abclonal	50 ul	EUR 223

VAMP1 antibody
70R-21229	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal VAMP1 antibody

Vamp1 antibody
70R-9793	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal Vamp1 antibody

Vamp1 antibody
70R-9794	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal Vamp1 antibody

VAMP1 Antibody
49966-100ul	SAB	100ul	EUR 333

VAMP1 Antibody
49966-50ul	SAB	50ul	EUR 239

VAMP1 Antibody
40289-100ul	SAB	100ul	EUR 252

VAMP1 Antibody
1-CSB-PA240065	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VAMP1. Recognizes VAMP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

VAMP1 Antibody
1-CSB-PA188240	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VAMP1. Recognizes VAMP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:20-1:100

VAMP1 Antibody
1-CSB-PA025780GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against VAMP1. Recognizes VAMP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

VAMP1 Antibody
1-CSB-PA025780LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VAMP1. Recognizes VAMP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Polyclonal Vamp1 antibody - middle region
APR13934G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Vamp1 - middle region. This antibody is tested and proven to work in the following applications:

VAMP1 Polyclonal Antibody, HRP Conjugated
A63777	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

VAMP1 Polyclonal Antibody, FITC Conjugated
A63778	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

VAMP1 Polyclonal Antibody, Biotin Conjugated
A63779	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

VAMP1 Conjugated Antibody
C40289	SAB	100ul	EUR 397

VAMP1 Conjugated Antibody
C49966	SAB	100ul	EUR 397

anti- VAMP1 antibody
FNab09358	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:5000 IF: 1:20-1:200 Immunogen: vesicle-associated membrane protein 1(synaptobrevin 1) Uniprot ID: P23763 Gene ID: 6843 Research Area: Neuroscience, Developmental biology
Description: Antibody raised against VAMP1

VAMP1/2 antibody
10R-8383	Fitzgerald	100 ul	EUR 392
Description: Mouse monoclonal VAMP1/2 antibody

Human VAMP1 Antibody
32869-05111	AssayPro	150 ug	EUR 261

Anti-VAMP1 antibody
PAab09358	Lifescience Market	100 ug	EUR 386

Anti-VAMP1 antibody
STJ111459	St John's Laboratory	100 µl	EUR 277
Description: Synapotobrevins, syntaxins, and the synaptosomal-associated protein SNAP25 are the main components of a protein complex involved in the docking and/or fusion of synaptic vesicles with the presynaptic membrane. The protein encoded by this gene is a member of the vesicle-associated membrane protein (VAMP)/synaptobrevin family. Mutations in this gene are associated with autosomal dominant spastic ataxia 1. Multiple alternative splice variants have been described, but the full-length nature of some variants has not been defined.

Anti-VAMP1 antibody
STJ192365	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to VAMP1

Vamp1/ Rat Vamp1 ELISA Kit
ELI-44656r	Lifescience Market	96 Tests	EUR 886

VAMP1 siRNA
20-abx905998	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

VAMP1 siRNA
20-abx939310	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

VAMP1 siRNA
20-abx939311	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

VAMP1 / VAMP2 / VAMP3 Antibody
20-abx326473	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

VAMP1/VAMP2/VAMP3 Antibody
1-CSB-PA050186	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against VAMP1/VAMP2/VAMP3. Recognizes VAMP1/VAMP2/VAMP3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

VAMP1 Antibody, HRP conjugated
1-CSB-PA025780LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VAMP1. Recognizes VAMP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

VAMP1 Antibody, FITC conjugated
1-CSB-PA025780LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VAMP1. Recognizes VAMP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

VAMP1 Antibody, Biotin conjugated
1-CSB-PA025780LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VAMP1. Recognizes VAMP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

VAMP1 cloning plasmid
CSB-CL025780HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 354 Sequence: atgtctgctccagctcagccacctgctgaagggacagaagggactgccccaggtgggggtccccctggccctcctcctaacatgaccagtaacagacgactacagcaaacccaggcacaagtggaggaggtggtggacatcatacgtgtgaacgtggacaaggtcctggagaggga Show more
Description: A cloning plasmid for the VAMP1 gene.

Vamp1 Blocking Peptide
33R-2033	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Vamp1 antibody, catalog no. 70R-9793

Vamp1 Blocking Peptide
33R-2531	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Vamp1 antibody, catalog no. 70R-9794

anti-VAMP1 (5F3)
LF-MA10378	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to VAMP1

Anti-VAMP1 (5A4)
YF-MA10897	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to VAMP1

Human VAMP1 Antibody (Biotin Conjugate)
32869-05121	AssayPro	150 ug	EUR 369

Anti-VAMP1/2 Monoclonal Antibody
M05982	BosterBio	100ug	EUR 397
Description: Mouse Monoclonal VAMP1/2 Antibody. Validated in ELISA, IHC, WB and tested in Human, Rat.

Monoclonal antibody for VAMP1/2
SMC-179C	Stressmarq	0.025mg	EUR 170
VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1) Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is not conjugated.

Monoclonal antibody for VAMP1/2
SMC-179D	Stressmarq	0.1mg	EUR 302
VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1) Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is not conjugated.

Monoclonal antibody for VAMP1/2
SMC-179D-A390	Stressmarq	0.1mg	EUR 349
VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1) Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with ATTO 390.

Monoclonal antibody for VAMP1/2
SMC-179D-A488	Stressmarq	0.1mg	EUR 348
VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1) Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with ATTO 488.

Monoclonal antibody for VAMP1/2
SMC-179D-A565	Stressmarq	0.1mg	EUR 348
VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1) Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with ATTO 565.

Monoclonal antibody for VAMP1/2
SMC-179D-A594	Stressmarq	0.1mg	EUR 348
VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1) Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with ATTO 594.

Monoclonal antibody for VAMP1/2
SMC-179D-A633	Stressmarq	0.1mg	EUR 348
VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1) Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with ATTO 633.

Monoclonal antibody for VAMP1/2
SMC-179D-A655	Stressmarq	0.1mg	EUR 348
VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1) Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with ATTO 655.

Monoclonal antibody for VAMP1/2
SMC-179D-A680	Stressmarq	0.1mg	EUR 348
VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1) Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with ATTO 680.

Monoclonal antibody for VAMP1/2
SMC-179D-A700	Stressmarq	0.1mg	EUR 348
VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1) Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with ATTO 700.

Monoclonal antibody for VAMP1/2
SMC-179D-ALP	Stressmarq	0.1mg	EUR 342
VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1) Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with Alkaline Phosphatase.

Monoclonal antibody for VAMP1/2
SMC-179D-APC	Stressmarq	0.1mg	EUR 347
VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1) Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with APC.

Monoclonal antibody for VAMP1/2
SMC-179D-APCCY7	Stressmarq	0.1mg	EUR 419
VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1) Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with APC/Cy7.

Monoclonal antibody for VAMP1/2
SMC-179D-BI	Stressmarq	0.1mg	EUR 344
VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1) Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with Biotin.

Monoclonal antibody for VAMP1/2
SMC-179D-DY350	Stressmarq	0.1mg	EUR 362
VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1) Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with Dylight 350.

Monoclonal antibody for VAMP1/2
SMC-179D-DY405	Stressmarq	0.1mg	EUR 351
VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1) Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with Dylight 405.

Monoclonal antibody for VAMP1/2
SMC-179D-DY488	Stressmarq	0.1mg	EUR 341
VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1) Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with Dylight 488.

Monoclonal antibody for VAMP1/2
SMC-179D-DY594	Stressmarq	0.1mg	EUR 343
VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1) Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with Dylight 594.

Monoclonal antibody for VAMP1/2
SMC-179D-DY633	Stressmarq	0.1mg	EUR 338
VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1) Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with Dylight 633.

Monoclonal antibody for VAMP1/2
SMC-179D-FITC	Stressmarq	0.1mg	EUR 340
VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1) Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with FITC.

Monoclonal antibody for VAMP1/2
SMC-179D-HRP	Stressmarq	0.1mg	EUR 336
VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1) Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with HRP.

Monoclonal antibody for VAMP1/2
SMC-179D-P594	Stressmarq	0.1mg	EUR 355
VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1) Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with PE/ATTO 594.

Monoclonal antibody for VAMP1/2
SMC-179D-PCP	Stressmarq	0.1mg	EUR 347
VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1) Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with PerCP.

Monoclonal antibody for VAMP1/2
SMC-179D-RPE	Stressmarq	0.1mg	EUR 345
VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1) Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat | Pig VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with RPE.

Monoclonal antibody for VAMP1/2
SMC-179D-STR	Stressmarq	0.1mg	EUR 346
VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1) Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat | Pig VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is conjugated with Streptavidin.

Monoclonal antibody for VAMP1/2
SMC-179S	Stressmarq	0.012mg	EUR 65
VAMP-1, also known as vesicle-associated membrane protein, is an 18kDa member of the synaptobrevin family of proteins. It is expressed in neurons, neutrophils, and skeletal muscle cells, and participates in vesicle fusion with the plasma membrane (1) Show more
Description: A monoclonal antibody from clone SP-11 against Human | Mouse | Rat | Pig VAMP1/2. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Crude human synaptic immunoprecipitate. The antibody is tested and validated for WB, IHC, ELISA assays with the following recommended dilutions: WB (1:1000), IHC (1:1000). This MAb for VAMP1/2 is not conjugated.

Anti-VAMP1, 2, 3 antibody
STJ13100474	St John's Laboratory	100 µl	EUR 427

VAMP1 Rabbit Polyclonal Antibody