VASN Rabbit Polyclonal Antibody

VASN Rabbit Polyclonal Antibody

Human Vasorin (VASN) ELISA Kit
RDR-VASN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Vasorin (VASN) ELISA Kit
RDR-VASN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Vasorin (VASN) ELISA Kit
RDR-VASN-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Vasorin (VASN) ELISA Kit
RDR-VASN-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Human Vasorin (VASN) ELISA Kit
RD-VASN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Vasorin (VASN) ELISA Kit
RD-VASN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Vasorin (VASN) ELISA Kit
RD-VASN-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Vasorin (VASN) ELISA Kit
RD-VASN-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

VASN Polyclonal Antibody
29780-100ul	SAB	100ul	EUR 252

VASN Polyclonal Antibody
29780-50ul	SAB	50ul	EUR 187

VASN Polyclonal Antibody
ABP60871-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human VASN protein Applications tips:
Description: A polyclonal antibody for detection of VASN from Human, Mouse. This VASN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VASN protein

VASN Polyclonal Antibody
ABP60871-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human VASN protein Applications tips:
Description: A polyclonal antibody for detection of VASN from Human, Mouse. This VASN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VASN protein

VASN Polyclonal Antibody
ABP60871-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human VASN protein Applications tips:
Description: A polyclonal antibody for detection of VASN from Human, Mouse. This VASN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VASN protein

VASN Polyclonal Antibody
ES10988-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VASN from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

VASN Polyclonal Antibody
ES10988-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VASN from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

VASN Rabbit pAb
A16215-100ul	Abclonal	100 ul	EUR 308

VASN Rabbit pAb
A16215-200ul	Abclonal	200 ul	EUR 459

VASN Rabbit pAb
A16215-20ul	Abclonal	20 ul	EUR 183

VASN Rabbit pAb
A16215-50ul	Abclonal	50 ul	EUR 223

VASN Polyclonal Conjugated Antibody
C29780	SAB	100ul	EUR 397

VASN Antibody
1-CSB-PA025796OA01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VASN. Recognizes VASN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:500-1:1000, IF:1:200-1:500

Vasorin (VASN) Polyclonal Antibody (Mouse)
4-PAG905Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VASN (Asn299~Ala559) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN)

Vasorin (VASN) Polyclonal Antibody (Human, Mouse)
4-PAG905Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VASN (Asn298~Gly539) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN)

Vasorin (VASN) Polyclonal Antibody (Mouse), APC
4-PAG905Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VASN (Asn299~Ala559) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with APC.

Vasorin (VASN) Polyclonal Antibody (Mouse), Biotinylated
4-PAG905Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VASN (Asn299~Ala559) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with Biotin.

Vasorin (VASN) Polyclonal Antibody (Mouse), Cy3
4-PAG905Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VASN (Asn299~Ala559) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with Cy3.

Vasorin (VASN) Polyclonal Antibody (Mouse), FITC
4-PAG905Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VASN (Asn299~Ala559) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with FITC.

Vasorin (VASN) Polyclonal Antibody (Mouse), HRP
4-PAG905Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VASN (Asn299~Ala559) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with HRP.

Vasorin (VASN) Polyclonal Antibody (Mouse), PE
4-PAG905Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VASN (Asn299~Ala559) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with PE.

Vasorin (VASN) Antibody
20-abx178861	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Vasorin (VASN) Antibody
20-abx128643	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Vasorin (VASN) Antibody
20-abx129867	Abbexa	EUR 314.00 EUR 133.00 EUR 829.00 EUR 439.00 EUR 272.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Vasorin (VASN) Antibody
20-abx175081	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Vasorin (VASN) Antibody
abx029986-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Vasorin (VASN) Antibody
abx029986-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Anti-VASN antibody
STJ118668	St John's Laboratory	100 µl	EUR 277

Anti-VASN antibody
STJ192146	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to VASN

Vasorin (VASN) Polyclonal Antibody (Human, Mouse), APC
4-PAG905Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VASN (Asn298~Gly539) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with APC.

Vasorin (VASN) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAG905Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VASN (Asn298~Gly539) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with Biotin.

Vasorin (VASN) Polyclonal Antibody (Human, Mouse), Cy3
4-PAG905Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VASN (Asn298~Gly539) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with Cy3.

Vasorin (VASN) Polyclonal Antibody (Human, Mouse), FITC
4-PAG905Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VASN (Asn298~Gly539) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with FITC.

Vasorin (VASN) Polyclonal Antibody (Human, Mouse), HRP
4-PAG905Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VASN (Asn298~Gly539) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with HRP.

Vasorin (VASN) Polyclonal Antibody (Human, Mouse), PE
4-PAG905Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VASN (Asn298~Gly539) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with PE.

Vasorin (VASN) Polyclonal Antibody (Mouse), APC-Cy7
4-PAG905Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VASN (Asn299~Ala559) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with APC-Cy7.

VASN siRNA
20-abx939340	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

VASN siRNA
20-abx939341	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

VASN Antibody, HRP conjugated
1-CSB-PA025796OB01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VASN. Recognizes VASN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

VASN Antibody, FITC conjugated
1-CSB-PA025796OC01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VASN. Recognizes VASN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

VASN Antibody, Biotin conjugated
1-CSB-PA025796OD01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VASN. Recognizes VASN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Vasorin (VASN) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAG905Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VASN (Asn298~Gly539) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with APC-Cy7.

VASN cloning plasmid
CSB-CL025796HU-10ug	Cusabio	10ug	EUR 675
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2022 Sequence: atgtgctccagggtccctctgctgctgccgctgctcctgctactggccctggggcctggggtgcagggctgcccatccggctgccagtgcagccagccacagacagtcttctgcactgcccgccaggggaccacggtgccccgagacgtgccacccgacacggtggggctgtacg Show more
Description: A cloning plasmid for the VASN gene.

Recombinant human VASN
P1430	FN Test	100ug	Ask for price
Uniprot ID: Q6EMK4 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human VASN

Recombinant Vasorin (VASN)
4-RPG905Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q6EMK4 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 29.8kDa Isoelectric Point: 8.7
Description: Recombinant Human Vasorin expressed in: E.coli

Recombinant Vasorin (VASN)
4-RPG905Mu01	Cloud-Clone	EUR 490.66 EUR 234.00 EUR 1564.96 EUR 588.32 EUR 1076.64 EUR 391.00 EUR 3762.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9CZT5 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 32.1kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Vasorin expressed in: E.coli

Mouse Vasorin (VASN) Protein
20-abx167307	Abbexa	EUR 690.00 EUR 286.00 EUR 2110.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Vasorin (VASN) Protein
20-abx168095	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human VASN shRNA Plasmid
20-abx964422	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse VASN shRNA Plasmid
20-abx982806	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

VASN Recombinant Protein (Rat)
RP236282	ABM	100 ug	Ask for price

VASN Recombinant Protein (Human)
RP034255	ABM	100 ug	Ask for price

VASN Recombinant Protein (Mouse)
RP183656	ABM	100 ug	Ask for price

Human Vasorin (VASN) ELISA Kit
20-abx153457	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Vasorin (VASN) ELISA Kit
20-abx154839	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Vasorin (VASN) ELISA Kit
abx255015-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Mouse Vasn/ Vasorin ELISA Kit
E1569Mo	Sunlong	1 Kit	EUR 571

Human VASN/ Vasorin ELISA Kit
E2651Hu	Sunlong	1 Kit	EUR 571

Human Vasorin, VASN ELISA KIT
ELI-05447h	Lifescience Market	96 Tests	EUR 824

Mouse Vasorin, Vasn ELISA KIT
ELI-05448m	Lifescience Market	96 Tests	EUR 865

Mouse Vasorin (VASN) ELISA Kit
abx571795-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Vasorin (VASN) ELISA Kit
abx572543-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Vasorin (VASN) CLIA Kit
20-abx495324	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Vasorin (VASN) CLIA Kit
20-abx495325	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Vasn(Vasorin) ELISA Kit
EM0665	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: Q9CZT5 Alias: Vasn/Protein slit-like 2/Atia/Slitl2/VASN/Protein slit-like 2/SLITL2/slit-like 2/slit-like 2(Drosophila)/vasorin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

Vasn ORF Vector (Mouse) (pORF)
ORF061220	ABM	1.0 ug DNA	EUR 506

Vasn ORF Vector (Rat) (pORF)
ORF078762	ABM	1.0 ug DNA	EUR 506

VASN ORF Vector (Human) (pORF)
ORF011419	ABM	1.0 ug DNA	EUR 95

Human Vasorin ELISA Kit (VASN)
RK02486	Abclonal	96 Tests	EUR 521

Human Vasorin (VASN) ELISA Kit
SEG905Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasorin (VASN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasorin (VASN) in tissue homogenates, cell lysates and other biological fluids.

Human Vasorin (VASN) ELISA Kit
SEG905Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasorin (VASN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasorin (VASN) in tissue homogenates, cell lysates and other biological fluids.

Human Vasorin (VASN) ELISA Kit
SEG905Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasorin (VASN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasorin (VASN) in tissue homogenates, cell lysates and other biological fluids.

VASN Rabbit Polyclonal Antibody