CelltaGen
셀타젠 Genetic Genotyping

VASN Rabbit Polyclonal Antibody

Human Vasorin (VASN) ELISA Kit

RDR-VASN-Hu-48Tests 48 Tests
EUR 544

Human Vasorin (VASN) ELISA Kit

RDR-VASN-Hu-96Tests 96 Tests
EUR 756

Mouse Vasorin (VASN) ELISA Kit

RDR-VASN-Mu-48Tests 48 Tests
EUR 557

Mouse Vasorin (VASN) ELISA Kit

RDR-VASN-Mu-96Tests 96 Tests
EUR 774

Human Vasorin (VASN) ELISA Kit

RD-VASN-Hu-48Tests 48 Tests
EUR 521

Human Vasorin (VASN) ELISA Kit

RD-VASN-Hu-96Tests 96 Tests
EUR 723

Mouse Vasorin (VASN) ELISA Kit

RD-VASN-Mu-48Tests 48 Tests
EUR 533

Mouse Vasorin (VASN) ELISA Kit

RD-VASN-Mu-96Tests 96 Tests
EUR 740

VASN Polyclonal Antibody

29780-100ul 100ul
EUR 252

VASN Polyclonal Antibody

29780-50ul 50ul
EUR 187

VASN Polyclonal Antibody

ABP60871-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human VASN protein
  • Applications tips:
Description: A polyclonal antibody for detection of VASN from Human, Mouse. This VASN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VASN protein

VASN Polyclonal Antibody

ABP60871-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human VASN protein
  • Applications tips:
Description: A polyclonal antibody for detection of VASN from Human, Mouse. This VASN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VASN protein

VASN Polyclonal Antibody

ABP60871-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human VASN protein
  • Applications tips:
Description: A polyclonal antibody for detection of VASN from Human, Mouse. This VASN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VASN protein

VASN Polyclonal Antibody

ES10988-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VASN from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

VASN Polyclonal Antibody

ES10988-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VASN from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

VASN Rabbit pAb

A16215-100ul 100 ul
EUR 308

VASN Rabbit pAb

A16215-200ul 200 ul
EUR 459

VASN Rabbit pAb

A16215-20ul 20 ul
EUR 183

VASN Rabbit pAb

A16215-50ul 50 ul
EUR 223

VASN Polyclonal Conjugated Antibody

C29780 100ul
EUR 397

VASN Antibody

1-CSB-PA025796OA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VASN. Recognizes VASN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:500-1:1000, IF:1:200-1:500

Vasorin (VASN) Polyclonal Antibody (Mouse)

4-PAG905Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn299~Ala559)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN)

Vasorin (VASN) Polyclonal Antibody (Human, Mouse)

4-PAG905Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn298~Gly539)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN)

Vasorin (VASN) Polyclonal Antibody (Mouse), APC

4-PAG905Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn299~Ala559)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with APC.

Vasorin (VASN) Polyclonal Antibody (Mouse), Biotinylated

4-PAG905Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn299~Ala559)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with Biotin.

Vasorin (VASN) Polyclonal Antibody (Mouse), Cy3

4-PAG905Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn299~Ala559)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with Cy3.

Vasorin (VASN) Polyclonal Antibody (Mouse), FITC

4-PAG905Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn299~Ala559)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with FITC.

Vasorin (VASN) Polyclonal Antibody (Mouse), HRP

4-PAG905Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn299~Ala559)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with HRP.

Vasorin (VASN) Polyclonal Antibody (Mouse), PE

4-PAG905Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn299~Ala559)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with PE.

Vasorin (VASN) Antibody

20-abx178861
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Vasorin (VASN) Antibody

20-abx128643
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Vasorin (VASN) Antibody

20-abx129867
  • EUR 314.00
  • EUR 133.00
  • EUR 829.00
  • EUR 439.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Vasorin (VASN) Antibody

20-abx175081
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Vasorin (VASN) Antibody

abx029986-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Vasorin (VASN) Antibody

abx029986-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Anti-VASN antibody

STJ118668 100 µl
EUR 277

Anti-VASN antibody

STJ192146 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to VASN

Vasorin (VASN) Polyclonal Antibody (Human, Mouse), APC

4-PAG905Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn298~Gly539)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with APC.

Vasorin (VASN) Polyclonal Antibody (Human, Mouse), Biotinylated

4-PAG905Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn298~Gly539)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with Biotin.

Vasorin (VASN) Polyclonal Antibody (Human, Mouse), Cy3

4-PAG905Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn298~Gly539)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with Cy3.

Vasorin (VASN) Polyclonal Antibody (Human, Mouse), FITC

4-PAG905Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn298~Gly539)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with FITC.

Vasorin (VASN) Polyclonal Antibody (Human, Mouse), HRP

4-PAG905Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn298~Gly539)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with HRP.

Vasorin (VASN) Polyclonal Antibody (Human, Mouse), PE

4-PAG905Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn298~Gly539)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with PE.

Vasorin (VASN) Polyclonal Antibody (Mouse), APC-Cy7

4-PAG905Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn299~Ala559)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with APC-Cy7.

VASN siRNA

20-abx939340
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

VASN siRNA

20-abx939341
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

VASN Antibody, HRP conjugated

1-CSB-PA025796OB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VASN. Recognizes VASN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

VASN Antibody, FITC conjugated

1-CSB-PA025796OC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VASN. Recognizes VASN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

VASN Antibody, Biotin conjugated

1-CSB-PA025796OD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VASN. Recognizes VASN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Vasorin (VASN) Polyclonal Antibody (Human, Mouse), APC-Cy7

4-PAG905Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn298~Gly539)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with APC-Cy7.

VASN cloning plasmid

CSB-CL025796HU-10ug 10ug
EUR 675
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2022
  • Sequence: atgtgctccagggtccctctgctgctgccgctgctcctgctactggccctggggcctggggtgcagggctgcccatccggctgccagtgcagccagccacagacagtcttctgcactgcccgccaggggaccacggtgccccgagacgtgccacccgacacggtggggctgtacg
  • Show more
Description: A cloning plasmid for the VASN gene.

Recombinant human VASN

P1430 100ug Ask for price
  • Uniprot ID: Q6EMK4
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human VASN

Recombinant Vasorin (VASN)

4-RPG905Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q6EMK4
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.8kDa
  • Isoelectric Point: 8.7
Description: Recombinant Human Vasorin expressed in: E.coli

Recombinant Vasorin (VASN)

4-RPG905Mu01
  • EUR 490.66
  • EUR 234.00
  • EUR 1564.96
  • EUR 588.32
  • EUR 1076.64
  • EUR 391.00
  • EUR 3762.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9CZT5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Vasorin expressed in: E.coli

Mouse Vasorin (VASN) Protein

20-abx167307
  • EUR 690.00
  • EUR 286.00
  • EUR 2110.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Vasorin (VASN) Protein

20-abx168095
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human VASN shRNA Plasmid

20-abx964422
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse VASN shRNA Plasmid

20-abx982806
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

VASN Recombinant Protein (Rat)

RP236282 100 ug Ask for price

VASN Recombinant Protein (Human)

RP034255 100 ug Ask for price

VASN Recombinant Protein (Mouse)

RP183656 100 ug Ask for price

Human Vasorin (VASN) ELISA Kit

20-abx153457
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Vasorin (VASN) ELISA Kit

20-abx154839
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Vasorin (VASN) ELISA Kit

abx255015-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Mouse Vasn/ Vasorin ELISA Kit

E1569Mo 1 Kit
EUR 571

Human VASN/ Vasorin ELISA Kit

E2651Hu 1 Kit
EUR 571

Human Vasorin, VASN ELISA KIT

ELI-05447h 96 Tests
EUR 824

Mouse Vasorin, Vasn ELISA KIT

ELI-05448m 96 Tests
EUR 865

Mouse Vasorin (VASN) ELISA Kit

abx571795-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Vasorin (VASN) ELISA Kit

abx572543-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Vasorin (VASN) CLIA Kit

20-abx495324
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Vasorin (VASN) CLIA Kit

20-abx495325
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Vasn(Vasorin) ELISA Kit

EM0665 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9CZT5
  • Alias: Vasn/Protein slit-like 2/Atia/Slitl2/VASN/Protein slit-like 2/SLITL2/slit-like 2/slit-like 2(Drosophila)/vasorin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

Vasn ORF Vector (Mouse) (pORF)

ORF061220 1.0 ug DNA
EUR 506

Vasn ORF Vector (Rat) (pORF)

ORF078762 1.0 ug DNA
EUR 506

VASN ORF Vector (Human) (pORF)

ORF011419 1.0 ug DNA
EUR 95

Human Vasorin ELISA Kit (VASN)

RK02486 96 Tests
EUR 521

Human Vasorin (VASN) ELISA Kit

SEG905Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasorin (VASN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasorin (VASN) in tissue homogenates, cell lysates and other biological fluids.

Human Vasorin (VASN) ELISA Kit

SEG905Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasorin (VASN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasorin (VASN) in tissue homogenates, cell lysates and other biological fluids.

Human Vasorin (VASN) ELISA Kit

SEG905Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasorin (VASN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasorin (VASN) in tissue homogenates, cell lysates and other biological fluids.

VASN Rabbit Polyclonal Antibody