VSIG4 Rabbit Polyclonal Antibody

VSIG4 Polyclonal Antibody
ABP60904-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human VSIG4 protein at amino acid sequence of 70-150 Applications tips:
Description: A polyclonal antibody for detection of VSIG4 from Human. This VSIG4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VSIG4 protein at amino acid sequence of 70-150

VSIG4 antibody
70R-1905	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal VSIG4 antibody raised against the N terminal of VSIG4

VSIG4 Antibody
1-CSB-PA896869LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VSIG4. Recognizes VSIG4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

Polyclonal VSIG4 Antibody (C-term)
APR04368G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VSIG4 (C-term). This antibody is tested and proven to work in the following applications:

VSIG4 Antibody (HRP)
20-abx316697	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

VSIG4 Antibody (FITC)
20-abx316698	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

VSIG4 Antibody (Biotin)
20-abx316699	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-VSIG4 antibody
STJ192339	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to VSIG4

VSIG4 siRNA
20-abx939568	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

VSIG4 Antibody, HRP conjugated
1-CSB-PA896869LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VSIG4. Recognizes VSIG4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

VSIG4 Antibody, FITC conjugated
1-CSB-PA896869LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VSIG4. Recognizes VSIG4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

VSIG4 Antibody, Biotin conjugated
1-CSB-PA896869LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VSIG4. Recognizes VSIG4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

VSIG4 Blocking Peptide
33R-9726	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VSIG4 antibody, catalog no. 70R-1905

VSIG4 cloning plasmid
CSB-CL896869HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1200 Sequence: atggggatcttactgggcctgctactcctggggcacctaacagtggacacttatggccgtcccatcctggaagtgccagagagtgtaacaggaccttggaaaggggatgtgaatcttccctgcacctatgaccccctgcaaggctacacccaagtcttggtgaagtggctggtac Show more
Description: A cloning plasmid for the VSIG4 gene.

Human VSIG4 ELISA KIT
ELI-15017h	Lifescience Market	96 Tests	EUR 824

Human VSIG4 shRNA Plasmid
20-abx957754	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Recombinant Human VSIG4 Protein
RP00286	Abclonal	20 μg	EUR 202

VSIG4 Recombinant Protein (Rat)
RP237083	ABM	100 ug	Ask for price

VSIG4 Recombinant Protein (Mouse)
RP185009	ABM	100 ug	Ask for price

Recombinant Mouse VSIG4 (C-6His)
CP83-10ug	Novoprotein	10ug	EUR 141
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse VSIG4 (C-6His)
CP83-1mg	Novoprotein	1mg	EUR 1674
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse VSIG4 (C-6His)
CP83-500ug	Novoprotein	500ug	EUR 1186
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse VSIG4 (C-6His)
CP83-50ug	Novoprotein	50ug	EUR 303
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Human CellExp? VSIG4, human recombinant
P1018-10	Biovision		EUR 207

Human CellExp? VSIG4, human recombinant
P1018-50	Biovision		EUR 479

Vsig4 ORF Vector (Rat) (pORF)
ORF079029	ABM	1.0 ug DNA	EUR 506

VSIG4 ORF Vector (Human) (pORF)
ORF011484	ABM	1.0 ug DNA	EUR 95

Vsig4 ORF Vector (Mouse) (pORF)
ORF061671	ABM	1.0 ug DNA	EUR 506

VSIG4 ELISA Kit (Human) (OKCA00860)
OKCA00860	Aviva Systems Biology	96 Wells	EUR 833
Description: Description of target: Phagocytic receptor, strong negative regulator of T-cell proliferation and IL2 production. Potent inhibitor of the alternative complement pathway convertases.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.81 pg/mL

VSIG4 ELISA Kit (Human) (OKEH08599)
OKEH08599	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: This gene encodes a v-set and immunoglobulin-domain containing protein that is structurally related to the B7 family of immune regulatory proteins. The encoded protein may be a negative regulator of T-cell responses. This protein is also a receptor for the complement component 3 fragments C3b and iC3b. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.22ng/ml

VSIG4 sgRNA CRISPR Lentivector set (Human)
K2620901	ABM	3 x 1.0 ug	EUR 339

Vsig4 sgRNA CRISPR Lentivector set (Mouse)
K4242501	ABM	3 x 1.0 ug	EUR 339

Vsig4 sgRNA CRISPR Lentivector set (Rat)
K7367501	ABM	3 x 1.0 ug	EUR 339

VSIG4 sgRNA CRISPR Lentivector (Human) (Target 1)
K2620902	ABM	1.0 ug DNA	EUR 154

VSIG4 sgRNA CRISPR Lentivector (Human) (Target 2)
K2620903	ABM	1.0 ug DNA	EUR 154

VSIG4 sgRNA CRISPR Lentivector (Human) (Target 3)
K2620904	ABM	1.0 ug DNA	EUR 154

Vsig4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4242502	ABM	1.0 ug DNA	EUR 154

Vsig4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4242503	ABM	1.0 ug DNA	EUR 154

Vsig4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4242504	ABM	1.0 ug DNA	EUR 154

Vsig4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7367502	ABM	1.0 ug DNA	EUR 154

Vsig4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7367503	ABM	1.0 ug DNA	EUR 154

Vsig4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7367504	ABM	1.0 ug DNA	EUR 154

VSIG4 Protein Vector (Human) (pPB-C-His)
PV045933	ABM	500 ng	EUR 329

VSIG4 Protein Vector (Human) (pPB-N-His)
PV045934	ABM	500 ng	EUR 329

VSIG4 Protein Vector (Human) (pPM-C-HA)
PV045935	ABM	500 ng	EUR 329

VSIG4 Protein Vector (Human) (pPM-C-His)
PV045936	ABM	500 ng	EUR 329

VSIG4 Protein Vector (Rat) (pPB-C-His)
PV316114	ABM	500 ng	EUR 603

VSIG4 Rabbit Polyclonal Antibody