VSIG4 Rabbit Polyclonal Antibody
 VSIG4 Polyclonal Antibody |
|
ABP60904-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human VSIG4 protein at amino acid sequence of 70-150
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VSIG4 from Human. This VSIG4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VSIG4 protein at amino acid sequence of 70-150 |
 VSIG4 antibody |
|
70R-1905 |
Fitzgerald |
100 ug |
EUR 377 |
|
Description: Rabbit polyclonal VSIG4 antibody raised against the N terminal of VSIG4 |
 VSIG4 Antibody |
|
1-CSB-PA896869LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against VSIG4. Recognizes VSIG4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
) Polyclonal VSIG4 Antibody (C-term) |
|
APR04368G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VSIG4 (C-term). This antibody is tested and proven to work in the following applications: |
) VSIG4 Antibody (HRP) |
|
20-abx316697 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) VSIG4 Antibody (FITC) |
|
20-abx316698 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) VSIG4 Antibody (Biotin) |
|
20-abx316699 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Anti-VSIG4 antibody |
|
STJ192339 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to VSIG4 |
 VSIG4 siRNA |
|
20-abx939568 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 VSIG4 Antibody, HRP conjugated |
|
1-CSB-PA896869LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against VSIG4. Recognizes VSIG4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 VSIG4 Antibody, FITC conjugated |
|
1-CSB-PA896869LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against VSIG4. Recognizes VSIG4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 VSIG4 Antibody, Biotin conjugated |
|
1-CSB-PA896869LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against VSIG4. Recognizes VSIG4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 VSIG4 Blocking Peptide |
|
33R-9726 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VSIG4 antibody, catalog no. 70R-1905 |
 VSIG4 cloning plasmid |
|
CSB-CL896869HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1200
- Sequence: atggggatcttactgggcctgctactcctggggcacctaacagtggacacttatggccgtcccatcctggaagtgccagagagtgtaacaggaccttggaaaggggatgtgaatcttccctgcacctatgaccccctgcaaggctacacccaagtcttggtgaagtggctggtac
- Show more
|
|
Description: A cloning plasmid for the VSIG4 gene. |
 Human VSIG4 shRNA Plasmid |
|
20-abx957754 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Recombinant Human VSIG4 Protein |
|
RP00286 |
Abclonal |
20 μg |
EUR 202 |
) VSIG4 Recombinant Protein (Rat) |
|
RP237083 |
ABM |
100 ug |
Ask for price |
) VSIG4 Recombinant Protein (Mouse) |
|
RP185009 |
ABM |
100 ug |
Ask for price |
) Recombinant Mouse VSIG4 (C-6His) |
|
CP83-10ug |
Novoprotein |
10ug |
EUR 141 |
|
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4. |
Recombinant Mouse VSIG4 (C-6His) |
|
CP83-1mg |
Novoprotein |
1mg |
EUR 1674 |
|
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4. |
Recombinant Mouse VSIG4 (C-6His) |
|
CP83-500ug |
Novoprotein |
500ug |
EUR 1186 |
|
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4. |
Recombinant Mouse VSIG4 (C-6His) |
|
CP83-50ug |
Novoprotein |
50ug |
EUR 303 |
|
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4. |
 Human CellExp? VSIG4, human recombinant |
|
P1018-10 |
Biovision |
|
EUR 207 |
Human CellExp? VSIG4, human recombinant |
|
P1018-50 |
Biovision |
|
EUR 479 |
 (pORF)) Vsig4 ORF Vector (Rat) (pORF) |
|
ORF079029 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) VSIG4 ORF Vector (Human) (pORF) |
|
ORF011484 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Vsig4 ORF Vector (Mouse) (pORF) |
|
ORF061671 |
ABM |
1.0 ug DNA |
EUR 506 |
 (OKCA00860)) VSIG4 ELISA Kit (Human) (OKCA00860) |
|
OKCA00860 |
Aviva Systems Biology |
96 Wells |
EUR 833 |
|
Description: Description of target: Phagocytic receptor, strong negative regulator of T-cell proliferation and IL2 production. Potent inhibitor of the alternative complement pathway convertases.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.81 pg/mL |
 (OKEH08599)) VSIG4 ELISA Kit (Human) (OKEH08599) |
|
OKEH08599 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
|
Description: Description of target: This gene encodes a v-set and immunoglobulin-domain containing protein that is structurally related to the B7 family of immune regulatory proteins. The encoded protein may be a negative regulator of T-cell responses. This protein is also a receptor for the complement component 3 fragments C3b and iC3b. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.22ng/ml |
) VSIG4 sgRNA CRISPR Lentivector set (Human) |
|
K2620901 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Vsig4 sgRNA CRISPR Lentivector set (Mouse) |
|
K4242501 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Vsig4 sgRNA CRISPR Lentivector set (Rat) |
|
K7367501 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) VSIG4 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2620902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) VSIG4 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K2620903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) VSIG4 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K2620904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Vsig4 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4242502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Vsig4 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4242503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Vsig4 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4242504 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Vsig4 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7367502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Vsig4 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7367503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Vsig4 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7367504 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) VSIG4 Protein Vector (Human) (pPB-C-His) |
|
PV045933 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) VSIG4 Protein Vector (Human) (pPB-N-His) |
|
PV045934 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) VSIG4 Protein Vector (Human) (pPM-C-HA) |
|
PV045935 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) VSIG4 Protein Vector (Human) (pPM-C-His) |
|
PV045936 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) VSIG4 Protein Vector (Rat) (pPB-C-His) |
|
PV316114 |
ABM |
500 ng |
EUR 603 |
VSIG4 Rabbit Polyclonal Antibody
