셀타젠 Genetic Genotyping

VSIG4 Rabbit Polyclonal Antibody

VSIG4 Polyclonal Antibody

ABP60904-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human VSIG4 protein at amino acid sequence of 70-150
  • Applications tips:
Description: A polyclonal antibody for detection of VSIG4 from Human. This VSIG4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VSIG4 protein at amino acid sequence of 70-150

VSIG4 antibody

70R-1905 100 ug
EUR 377
Description: Rabbit polyclonal VSIG4 antibody raised against the N terminal of VSIG4

VSIG4 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VSIG4. Recognizes VSIG4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

Polyclonal VSIG4 Antibody (C-term)

APR04368G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VSIG4 (C-term). This antibody is tested and proven to work in the following applications:

VSIG4 Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

VSIG4 Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

VSIG4 Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-VSIG4 antibody

STJ192339 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to VSIG4


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

VSIG4 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VSIG4. Recognizes VSIG4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

VSIG4 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VSIG4. Recognizes VSIG4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

VSIG4 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VSIG4. Recognizes VSIG4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

VSIG4 Blocking Peptide

33R-9726 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VSIG4 antibody, catalog no. 70R-1905

VSIG4 cloning plasmid

CSB-CL896869HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1200
  • Sequence: atggggatcttactgggcctgctactcctggggcacctaacagtggacacttatggccgtcccatcctggaagtgccagagagtgtaacaggaccttggaaaggggatgtgaatcttccctgcacctatgaccccctgcaaggctacacccaagtcttggtgaagtggctggtac
  • Show more
Description: A cloning plasmid for the VSIG4 gene.


ELI-15017h 96 Tests
EUR 824

Human VSIG4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Human VSIG4 Protein

RP00286 20 μg
EUR 202

VSIG4 Recombinant Protein (Rat)

RP237083 100 ug Ask for price

VSIG4 Recombinant Protein (Mouse)

RP185009 100 ug Ask for price

Recombinant Mouse VSIG4 (C-6His)

CP83-10ug 10ug
EUR 141
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse VSIG4 (C-6His)

CP83-1mg 1mg
EUR 1674
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse VSIG4 (C-6His)

CP83-500ug 500ug
EUR 1186
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Mouse VSIG4 (C-6His)

CP83-50ug 50ug
EUR 303
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Human CellExp? VSIG4, human recombinant

EUR 207

Human CellExp? VSIG4, human recombinant

EUR 479

Vsig4 ORF Vector (Rat) (pORF)

ORF079029 1.0 ug DNA
EUR 506

VSIG4 ORF Vector (Human) (pORF)

ORF011484 1.0 ug DNA
EUR 95

Vsig4 ORF Vector (Mouse) (pORF)

ORF061671 1.0 ug DNA
EUR 506

VSIG4 ELISA Kit (Human) (OKCA00860)

OKCA00860 96 Wells
EUR 833
Description: Description of target: Phagocytic receptor, strong negative regulator of T-cell proliferation and IL2 production. Potent inhibitor of the alternative complement pathway convertases.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.81 pg/mL

VSIG4 ELISA Kit (Human) (OKEH08599)

OKEH08599 96 Wells
EUR 896
Description: Description of target: This gene encodes a v-set and immunoglobulin-domain containing protein that is structurally related to the B7 family of immune regulatory proteins. The encoded protein may be a negative regulator of T-cell responses. This protein is also a receptor for the complement component 3 fragments C3b and iC3b. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.22ng/ml

VSIG4 sgRNA CRISPR Lentivector set (Human)

K2620901 3 x 1.0 ug
EUR 339

Vsig4 sgRNA CRISPR Lentivector set (Mouse)

K4242501 3 x 1.0 ug
EUR 339

Vsig4 sgRNA CRISPR Lentivector set (Rat)

K7367501 3 x 1.0 ug
EUR 339

VSIG4 sgRNA CRISPR Lentivector (Human) (Target 1)

K2620902 1.0 ug DNA
EUR 154

VSIG4 sgRNA CRISPR Lentivector (Human) (Target 2)

K2620903 1.0 ug DNA
EUR 154

VSIG4 sgRNA CRISPR Lentivector (Human) (Target 3)

K2620904 1.0 ug DNA
EUR 154

Vsig4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4242502 1.0 ug DNA
EUR 154

Vsig4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4242503 1.0 ug DNA
EUR 154

Vsig4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4242504 1.0 ug DNA
EUR 154

Vsig4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7367502 1.0 ug DNA
EUR 154

Vsig4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7367503 1.0 ug DNA
EUR 154

Vsig4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7367504 1.0 ug DNA
EUR 154

VSIG4 Protein Vector (Human) (pPB-C-His)

PV045933 500 ng
EUR 329

VSIG4 Protein Vector (Human) (pPB-N-His)

PV045934 500 ng
EUR 329

VSIG4 Protein Vector (Human) (pPM-C-HA)

PV045935 500 ng
EUR 329

VSIG4 Protein Vector (Human) (pPM-C-His)

PV045936 500 ng
EUR 329

VSIG4 Protein Vector (Rat) (pPB-C-His)

PV316114 500 ng
EUR 603

VSIG4 Rabbit Polyclonal Antibody