VSIG4 Rabbit Polyclonal Antibody
 VSIG4 Polyclonal Antibody |
|
ES11181-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VSIG4 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 VSIG4 antibody |
|
70R-1905 |
Fitzgerald |
100 ug |
EUR 377 |
|
Description: Rabbit polyclonal VSIG4 antibody raised against the N terminal of VSIG4 |
 VSIG4 Antibody |
|
1-CSB-PA896869LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against VSIG4. Recognizes VSIG4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
) Polyclonal VSIG4 Antibody (C-term) |
|
APR04368G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VSIG4 (C-term). This antibody is tested and proven to work in the following applications: |
) VSIG4 Antibody (HRP) |
|
20-abx316697 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) VSIG4 Antibody (FITC) |
|
20-abx316698 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) VSIG4 Antibody (Biotin) |
|
20-abx316699 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Anti-VSIG4 antibody |
|
STJ192339 |
St John's Laboratory |
200 ยตl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to VSIG4 |
 VSIG4 siRNA |
|
20-abx939568 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 VSIG4 Antibody, HRP conjugated |
|
1-CSB-PA896869LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against VSIG4. Recognizes VSIG4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 VSIG4 Antibody, FITC conjugated |
|
1-CSB-PA896869LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against VSIG4. Recognizes VSIG4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 VSIG4 Antibody, Biotin conjugated |
|
1-CSB-PA896869LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against VSIG4. Recognizes VSIG4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 VSIG4 Blocking Peptide |
|
33R-9726 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VSIG4 antibody, catalog no. 70R-1905 |
 VSIG4 cloning plasmid |
|
CSB-CL896869HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 รยผg plasmid + 200รยผl Glycerol
- Length: 1200
- Sequence: atggggatcttactgggcctgctactcctggggcacctaacagtggacacttatggccgtcccatcctggaagtgccagagagtgtaacaggaccttggaaaggggatgtgaatcttccctgcacctatgaccccctgcaaggctacacccaagtcttggtgaagtggctggtac
- Show more
|
|
Description: A cloning plasmid for the VSIG4 gene. |
 Human VSIG4 shRNA Plasmid |
|
20-abx957754 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) VSIG4 Recombinant Protein (Rat) |
|
RP237083 |
ABM |
100 ug |
Ask for price |
 Recombinant Human VSIG4 Protein |
|
RP00286 |
Abclonal |
20 ฮผg |
EUR 202 |
) VSIG4 Recombinant Protein (Mouse) |
|
RP185009 |
ABM |
100 ug |
Ask for price |
) Recombinant Mouse VSIG4 (C-6His) |
|
CP83-10ug |
Novoprotein |
10ug |
EUR 141 |
|
Description: Lyophilized from a 0.2 ฮผm filtered solution of PBS, pH7.4. |
Recombinant Mouse VSIG4 (C-6His) |
|
CP83-1mg |
Novoprotein |
1mg |
EUR 1674 |
|
Description: Lyophilized from a 0.2 ฮผm filtered solution of PBS, pH7.4. |
Recombinant Mouse VSIG4 (C-6His) |
|
CP83-500ug |
Novoprotein |
500ug |
EUR 1186 |
|
Description: Lyophilized from a 0.2 ฮผm filtered solution of PBS, pH7.4. |
Recombinant Mouse VSIG4 (C-6His) |
|
CP83-50ug |
Novoprotein |
50ug |
EUR 303 |
|
Description: Lyophilized from a 0.2 ฮผm filtered solution of PBS, pH7.4. |
 Human CellExp? VSIG4, human recombinant |
|
P1018-10 |
Biovision |
|
EUR 207 |
Human CellExp? VSIG4, human recombinant |
|
P1018-50 |
Biovision |
|
EUR 479 |
 (pORF)) Vsig4 ORF Vector (Mouse) (pORF) |
|
ORF061671 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Vsig4 ORF Vector (Rat) (pORF) |
|
ORF079029 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) VSIG4 ORF Vector (Human) (pORF) |
|
ORF011484 |
ABM |
1.0 ug DNA |
EUR 95 |
 (OKCA00860)) VSIG4 ELISA Kit (Human) (OKCA00860) |
|
OKCA00860 |
Aviva Systems Biology |
96 Wells |
EUR 833 |
|
Description: Description of target: Phagocytic receptor, strong negative regulator of T-cell proliferation and IL2 production. Potent inhibitor of the alternative complement pathway convertases.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.81 pg/mL |
 (OKEH08599)) VSIG4 ELISA Kit (Human) (OKEH08599) |
|
OKEH08599 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
|
Description: Description of target: This gene encodes a v-set and immunoglobulin-domain containing protein that is structurally related to the B7 family of immune regulatory proteins. The encoded protein may be a negative regulator of T-cell responses. This protein is also a receptor for the complement component 3 fragments C3b and iC3b. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.22ng/ml |
) Vsig4 sgRNA CRISPR Lentivector set (Rat) |
|
K7367501 |
ABM |
3 x 1.0 ug |
EUR 339 |
) VSIG4 sgRNA CRISPR Lentivector set (Human) |
|
K2620901 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Vsig4 sgRNA CRISPR Lentivector set (Mouse) |
|
K4242501 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) Vsig4 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7367502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Vsig4 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7367503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Vsig4 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7367504 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) VSIG4 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2620902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) VSIG4 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K2620903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) VSIG4 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K2620904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Vsig4 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4242502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Vsig4 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4242503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Vsig4 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4242504 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) VSIG4 Protein Vector (Mouse) (pPB-C-His) |
|
PV246682 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) VSIG4 Protein Vector (Mouse) (pPB-N-His) |
|
PV246683 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) VSIG4 Protein Vector (Mouse) (pPM-C-HA) |
|
PV246684 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) VSIG4 Protein Vector (Mouse) (pPM-C-His) |
|
PV246685 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) VSIG4 Protein Vector (Rat) (pPB-C-His) |
|
PV316114 |
ABM |
500 ng |
EUR 603 |
VSIG4 Rabbit Polyclonal Antibody
