CelltaGen
셀타젠 Genetic Genotyping

WASL Rabbit Polyclonal Antibody

WASL Rabbit mAb

A2270-100ul 100 ul
EUR 410

WASL Rabbit mAb

A2270-200ul 200 ul
EUR 571

WASL Rabbit mAb

A2270-20ul 20 ul
EUR 221

WASL Rabbit mAb

A2270-50ul 50 ul
EUR 287

WASL antibody

70R-21295 50 ul
EUR 435
Description: Rabbit polyclonal WASL antibody

WASL Antibody

ABD7029 100 ug
EUR 438

WASL Antibody

49725-100ul 100ul
EUR 333

WASL Antibody

49725-50ul 50ul
EUR 239

WASL Antibody

43021-100ul 100ul
EUR 252

WASL Antibody

32726-100ul 100ul
EUR 252

WASL Antibody

1-CSB-PA025973GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against WASL. Recognizes WASL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

Polyclonal WASL Antibody (N-term)

AMM08505G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WASL (N-term). This antibody is tested and proven to work in the following applications:

Wasl/ Rat Wasl ELISA Kit

ELI-51494r 96 Tests
EUR 886

WASL Conjugated Antibody

C43021 100ul
EUR 397

WASL Conjugated Antibody

C49725 100ul
EUR 397

WASL Conjugated Antibody

C32726 100ul
EUR 397

anti- WASL antibody

FNab09470 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200;IF: 1:10-1:100
  • Immunogen: Wiskott-Aldrich syndrome-like
  • Uniprot ID: O00401
  • Gene ID: 8976
  • Research Area: Neuroscience, Metabolism, cancer
Description: Antibody raised against WASL

Anti-WASL antibody

PAab09470 100 ug
EUR 386

Anti-WASL antibody

STJ110921 100 µl
EUR 277
Description: This gene encodes a member of the Wiskott-Aldrich syndrome (WAS) protein family. Wiskott-Aldrich syndrome proteins share similar domain structure, and associate with a variety of signaling molecules to alter the actin cytoskeleton. The encoded protein is highly expressed in neural tissues, and interacts with several proteins involved in cytoskeletal organization, including cell division control protein 42 (CDC42) and the actin-related protein-2/3 (ARP2/3) complex. The encoded protein may be involved in the formation of long actin microspikes, and in neurite extension.

Anti-WASL antibody

STJ26108 100 µl
EUR 277
Description: This gene encodes a member of the Wiskott-Aldrich syndrome (WAS) protein family. Wiskott-Aldrich syndrome proteins share similar domain structure, and associate with a variety of signaling molecules to alter the actin cytoskeleton. The encoded protein is highly expressed in neural tissues, and interacts with several proteins involved in cytoskeletal organization, including cell division control protein 42 (CDC42) and the actin-related protein-2/3 (ARP2/3) complex. The encoded protein may be involved in the formation of long actin microspikes, and in neurite extension.

Anti-WASL antibody

STJ192420 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to WASL

WASL siRNA

20-abx939642
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

WASL siRNA

20-abx939643
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

WASL recombinant monoclonal antibody

A5400 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human WASL for WB,ELISA

Anti-WASL Monoclonal Antibody

M05438 100ug
EUR 397
Description: Rabbit Monoclonal WASL Antibody. Validated in IF, WB and tested in Human, Mouse.

WASL cloning plasmid

CSB-CL025973HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1518
  • Sequence: atgagctccgtccagcagcagccgccgccgccgcggagggtcaccaacgtggggtccctgttgctcaccccgcaggagaacgagtccctcttcactttcctcggcaagaaatgtgtgactatgtcttcagcagtggtgcagttatatgcagcagatcggaactgtatgtggtcaa
  • Show more
Description: A cloning plasmid for the WASL gene.

Mouse WASL shRNA Plasmid

20-abx977926
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

WASL ELISA KIT|Human

EF004250 96 Tests
EUR 689

Human WASL shRNA Plasmid

20-abx955926
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

WASL Recombinant Protein (Human)

RP034510 100 ug Ask for price

WASL Recombinant Protein (Rat)

RP237164 100 ug Ask for price

WASL Recombinant Protein (Mouse)

RP185123 100 ug Ask for price

WASL Recombinant Protein (Mouse)

RP185126 100 ug Ask for price

Wiskott-Aldrich Syndrome-Like (WASL) Antibody

20-abx116678
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Monoclonal WASL Antibody (monoclonal) (M04), Clone: 5F4

AMM08504G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human WASL (monoclonal) (M04). The antibodies are raised in mouse and are from clone 5F4. This antibody is applicable in WB, IHC and IF

Neural Wiskott-Aldrich Syndrome Protein (WASL) Antibody

20-abx127083
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Neural Wiskott-Aldrich Syndrome Protein (WASL) Antibody

20-abx002013
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Neural Wiskott-Aldrich Syndrome Protein (WASL) Antibody

abx239470-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Wasl ORF Vector (Rat) (pORF)

ORF079056 1.0 ug DNA
EUR 506

WASL ORF Vector (Human) (pORF)

ORF011504 1.0 ug DNA
EUR 95

Wasl ORF Vector (Mouse) (pORF)

ORF061709 1.0 ug DNA
EUR 506

Wasl ORF Vector (Mouse) (pORF)

ORF061710 1.0 ug DNA
EUR 506

Was / Wasl Interacting Protein Family, Member 2 Antibody

20-abx116645
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

WASL sgRNA CRISPR Lentivector set (Human)

K2626001 3 x 1.0 ug
EUR 339

Wasl sgRNA CRISPR Lentivector set (Mouse)

K4550301 3 x 1.0 ug
EUR 339

Wasl sgRNA CRISPR Lentivector set (Rat)

K7509501 3 x 1.0 ug
EUR 339

WAS/WASL Interacting Protein Family Member 1 (WIPF1) Antibody

20-abx133536
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

WAS/WASL-Interacting Protein Family Member 2 (WIPF2) Antibody

abx026019-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

WAS/WASL-Interacting Protein Family Member 2 (WIPF2) Antibody

abx026019-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

WAS/WASL Interacting Protein Family Member 1 (WIPF1) Antibody

20-abx015004
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

WAS/WASL Interacting Protein Family Member 1 (WIPF1) Antibody

20-abx329117
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

WAS/WASL Interacting Protein Family Member 1 (WIPF1) Antibody

abx330771-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

WAS/WASL Interacting Protein Family Member 1 (WIPF1) Antibody

abx431652-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

WAS/WASL-Interacting Protein Family Member 2 (WIPF2) Antibody

abx239511-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

WASL sgRNA CRISPR Lentivector (Human) (Target 1)

K2626002 1.0 ug DNA
EUR 154

WASL sgRNA CRISPR Lentivector (Human) (Target 2)

K2626003 1.0 ug DNA
EUR 154

WASL sgRNA CRISPR Lentivector (Human) (Target 3)

K2626004 1.0 ug DNA
EUR 154

Wasl sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4550302 1.0 ug DNA
EUR 154

Wasl sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4550303 1.0 ug DNA
EUR 154

Wasl sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4550304 1.0 ug DNA
EUR 154

Wasl sgRNA CRISPR Lentivector (Rat) (Target 1)

K7509502 1.0 ug DNA
EUR 154

Wasl sgRNA CRISPR Lentivector (Rat) (Target 2)

K7509503 1.0 ug DNA
EUR 154

Wasl sgRNA CRISPR Lentivector (Rat) (Target 3)

K7509504 1.0 ug DNA
EUR 154

WASL Protein Vector (Human) (pPB-C-His)

PV046013 500 ng
EUR 329

WASL Protein Vector (Human) (pPB-N-His)

PV046014 500 ng
EUR 329

WASL Protein Vector (Human) (pPM-C-HA)

PV046015 500 ng
EUR 329

WASL Protein Vector (Human) (pPM-C-His)

PV046016 500 ng
EUR 329

WASL Protein Vector (Rat) (pPB-C-His)

PV316222 500 ng
EUR 603

WASL Protein Vector (Rat) (pPB-N-His)

PV316223 500 ng
EUR 603

WASL Protein Vector (Rat) (pPM-C-HA)

PV316224 500 ng
EUR 603

WASL Protein Vector (Rat) (pPM-C-His)

PV316225 500 ng
EUR 603

WASL Protein Vector (Mouse) (pPB-C-His)

PV246834 500 ng
EUR 603

WASL Protein Vector (Mouse) (pPB-N-His)

PV246835 500 ng
EUR 603

WASL Protein Vector (Mouse) (pPM-C-HA)

PV246836 500 ng
EUR 603

WASL Protein Vector (Mouse) (pPM-C-His)

PV246837 500 ng
EUR 603

WASL Protein Vector (Mouse) (pPB-C-His)

PV246838 500 ng
EUR 603

WASL Protein Vector (Mouse) (pPB-N-His)

PV246839 500 ng
EUR 603

WASL Protein Vector (Mouse) (pPM-C-HA)

PV246840 500 ng
EUR 603

WASL Protein Vector (Mouse) (pPM-C-His)

PV246841 500 ng
EUR 603

Wasl 3'UTR GFP Stable Cell Line

TU172188 1.0 ml Ask for price

WASL 3'UTR GFP Stable Cell Line

TU078369 1.0 ml
EUR 1521

Wasl 3'UTR Luciferase Stable Cell Line

TU122188 1.0 ml Ask for price

WASL 3'UTR Luciferase Stable Cell Line

TU028369 1.0 ml
EUR 1521

Wasl 3'UTR Luciferase Stable Cell Line

TU223306 1.0 ml Ask for price

Wasl 3'UTR GFP Stable Cell Line

TU273306 1.0 ml Ask for price

WASL Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV697687 1.0 ug DNA
EUR 682

WASL Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV697691 1.0 ug DNA
EUR 682

WASL Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV697692 1.0 ug DNA
EUR 682

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WASL Rabbit Polyclonal Antibody