셀타젠 Genetic Genotyping

WASL Rabbit Polyclonal Antibody

WASL Rabbit mAb

A2270-100ul 100 ul
EUR 410

WASL Rabbit mAb

A2270-200ul 200 ul
EUR 571

WASL Rabbit mAb

A2270-20ul 20 ul
EUR 221

WASL Rabbit mAb

A2270-50ul 50 ul
EUR 287

WASL antibody

70R-21295 50 ul
EUR 435
Description: Rabbit polyclonal WASL antibody

WASL Antibody

32726-100ul 100ul
EUR 252

WASL Antibody

49725-100ul 100ul
EUR 333

WASL Antibody

49725-50ul 50ul
EUR 239

WASL Antibody

43021-100ul 100ul
EUR 252

WASL Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against WASL. Recognizes WASL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

WASL Antibody

ABD7029 100 ug
EUR 438

Polyclonal WASL Antibody (N-term)

AMM08505G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WASL (N-term). This antibody is tested and proven to work in the following applications:

Wasl/ Rat Wasl ELISA Kit

ELI-51494r 96 Tests
EUR 886

WASL Conjugated Antibody

C49725 100ul
EUR 397

WASL Conjugated Antibody

C43021 100ul
EUR 397

WASL Conjugated Antibody

C32726 100ul
EUR 397

anti- WASL antibody

FNab09470 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200;IF: 1:10-1:100
  • Immunogen: Wiskott-Aldrich syndrome-like
  • Uniprot ID: O00401
  • Gene ID: 8976
  • Research Area: Neuroscience, Metabolism, cancer
Description: Antibody raised against WASL

Anti-WASL antibody

PAab09470 100 ug
EUR 386

Anti-WASL antibody

STJ110921 100 µl
EUR 277
Description: This gene encodes a member of the Wiskott-Aldrich syndrome (WAS) protein family. Wiskott-Aldrich syndrome proteins share similar domain structure, and associate with a variety of signaling molecules to alter the actin cytoskeleton. The encoded protein is highly expressed in neural tissues, and interacts with several proteins involved in cytoskeletal organization, including cell division control protein 42 (CDC42) and the actin-related protein-2/3 (ARP2/3) complex. The encoded protein may be involved in the formation of long actin microspikes, and in neurite extension.

Anti-WASL antibody

STJ26108 100 µl
EUR 277
Description: This gene encodes a member of the Wiskott-Aldrich syndrome (WAS) protein family. Wiskott-Aldrich syndrome proteins share similar domain structure, and associate with a variety of signaling molecules to alter the actin cytoskeleton. The encoded protein is highly expressed in neural tissues, and interacts with several proteins involved in cytoskeletal organization, including cell division control protein 42 (CDC42) and the actin-related protein-2/3 (ARP2/3) complex. The encoded protein may be involved in the formation of long actin microspikes, and in neurite extension.

Anti-WASL antibody

STJ192420 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to WASL


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

WASL recombinant monoclonal antibody

A5400 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human WASL for WB,ELISA

Anti-WASL Monoclonal Antibody

M05438 100ug
EUR 397
Description: Rabbit Monoclonal WASL Antibody. Validated in IF, WB and tested in Human, Mouse.

WASL cloning plasmid

CSB-CL025973HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1518
  • Sequence: atgagctccgtccagcagcagccgccgccgccgcggagggtcaccaacgtggggtccctgttgctcaccccgcaggagaacgagtccctcttcactttcctcggcaagaaatgtgtgactatgtcttcagcagtggtgcagttatatgcagcagatcggaactgtatgtggtcaa
  • Show more
Description: A cloning plasmid for the WASL gene.


EF004250 96 Tests
EUR 689

Mouse WASL shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human WASL shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

WASL Recombinant Protein (Rat)

RP237164 100 ug Ask for price

WASL Recombinant Protein (Human)

RP034510 100 ug Ask for price

WASL Recombinant Protein (Mouse)

RP185123 100 ug Ask for price

WASL Recombinant Protein (Mouse)

RP185126 100 ug Ask for price

Wiskott-Aldrich Syndrome-Like (WASL) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Monoclonal WASL Antibody (monoclonal) (M04), Clone: 5F4

AMM08504G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human WASL (monoclonal) (M04). The antibodies are raised in mouse and are from clone 5F4. This antibody is applicable in WB, IHC and IF

Neural Wiskott-Aldrich Syndrome Protein (WASL) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Neural Wiskott-Aldrich Syndrome Protein (WASL) Antibody

abx239470-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Neural Wiskott-Aldrich Syndrome Protein (WASL) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Wasl ORF Vector (Mouse) (pORF)

ORF061709 1.0 ug DNA
EUR 506

Wasl ORF Vector (Mouse) (pORF)

ORF061710 1.0 ug DNA
EUR 506

Wasl ORF Vector (Rat) (pORF)

ORF079056 1.0 ug DNA
EUR 506

WASL ORF Vector (Human) (pORF)

ORF011504 1.0 ug DNA
EUR 95

Was / Wasl Interacting Protein Family, Member 2 Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Wasl sgRNA CRISPR Lentivector set (Rat)

K7509501 3 x 1.0 ug
EUR 339

WASL sgRNA CRISPR Lentivector set (Human)

K2626001 3 x 1.0 ug
EUR 339

Wasl sgRNA CRISPR Lentivector set (Mouse)

K4550301 3 x 1.0 ug
EUR 339

WAS/WASL-Interacting Protein Family Member 2 (WIPF2) Antibody

abx026019-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

WAS/WASL-Interacting Protein Family Member 2 (WIPF2) Antibody

abx026019-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

WAS/WASL Interacting Protein Family Member 1 (WIPF1) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

WAS/WASL Interacting Protein Family Member 1 (WIPF1) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

WAS/WASL-Interacting Protein Family Member 2 (WIPF2) Antibody

abx239511-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

WAS/WASL Interacting Protein Family Member 1 (WIPF1) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

WAS/WASL Interacting Protein Family Member 1 (WIPF1) Antibody

abx330771-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

WAS/WASL Interacting Protein Family Member 1 (WIPF1) Antibody

abx431652-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Wasl sgRNA CRISPR Lentivector (Rat) (Target 1)

K7509502 1.0 ug DNA
EUR 154

Wasl sgRNA CRISPR Lentivector (Rat) (Target 2)

K7509503 1.0 ug DNA
EUR 154

Wasl sgRNA CRISPR Lentivector (Rat) (Target 3)

K7509504 1.0 ug DNA
EUR 154

WASL sgRNA CRISPR Lentivector (Human) (Target 1)

K2626002 1.0 ug DNA
EUR 154

WASL sgRNA CRISPR Lentivector (Human) (Target 2)

K2626003 1.0 ug DNA
EUR 154

WASL sgRNA CRISPR Lentivector (Human) (Target 3)

K2626004 1.0 ug DNA
EUR 154

Wasl sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4550302 1.0 ug DNA
EUR 154

Wasl sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4550303 1.0 ug DNA
EUR 154

Wasl sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4550304 1.0 ug DNA
EUR 154

WASL Protein Vector (Mouse) (pPB-C-His)

PV246834 500 ng
EUR 603

WASL Protein Vector (Mouse) (pPB-N-His)

PV246835 500 ng
EUR 603

WASL Protein Vector (Mouse) (pPM-C-HA)

PV246836 500 ng
EUR 603

WASL Protein Vector (Mouse) (pPM-C-His)

PV246837 500 ng
EUR 603

WASL Protein Vector (Mouse) (pPB-C-His)

PV246838 500 ng
EUR 603

WASL Protein Vector (Mouse) (pPB-N-His)

PV246839 500 ng
EUR 603

WASL Protein Vector (Mouse) (pPM-C-HA)

PV246840 500 ng
EUR 603

WASL Protein Vector (Mouse) (pPM-C-His)

PV246841 500 ng
EUR 603

WASL Protein Vector (Rat) (pPB-C-His)

PV316222 500 ng
EUR 603

WASL Protein Vector (Rat) (pPB-N-His)

PV316223 500 ng
EUR 603

WASL Protein Vector (Rat) (pPM-C-HA)

PV316224 500 ng
EUR 603

WASL Protein Vector (Rat) (pPM-C-His)

PV316225 500 ng
EUR 603

WASL Protein Vector (Human) (pPB-C-His)

PV046013 500 ng
EUR 329

WASL Protein Vector (Human) (pPB-N-His)

PV046014 500 ng
EUR 329

WASL Protein Vector (Human) (pPM-C-HA)

PV046015 500 ng
EUR 329

WASL Protein Vector (Human) (pPM-C-His)

PV046016 500 ng
EUR 329

Wasl 3'UTR Luciferase Stable Cell Line

TU122188 1.0 ml Ask for price

WASL 3'UTR GFP Stable Cell Line

TU078369 1.0 ml
EUR 1521

Wasl 3'UTR GFP Stable Cell Line

TU172188 1.0 ml Ask for price

Wasl 3'UTR Luciferase Stable Cell Line

TU223306 1.0 ml Ask for price

WASL 3'UTR Luciferase Stable Cell Line

TU028369 1.0 ml
EUR 1521

Wasl 3'UTR GFP Stable Cell Line

TU273306 1.0 ml Ask for price

WASL Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV697687 1.0 ug DNA
EUR 682

WASL Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV697691 1.0 ug DNA
EUR 682

WASL Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV697692 1.0 ug DNA
EUR 682

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

WASL Rabbit Polyclonal Antibody