XG Rabbit Polyclonal Antibody

XG Rabbit Polyclonal Antibody

XG Polyclonal Antibody
ABP60937-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human XG protein Applications tips:
Description: A polyclonal antibody for detection of XG from Human. This XG antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human XG protein

XG Polyclonal Antibody
ABP60937-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human XG protein Applications tips:
Description: A polyclonal antibody for detection of XG from Human. This XG antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human XG protein

XG Polyclonal Antibody
ES10962-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against XG from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

XG Polyclonal Antibody
ES10962-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against XG from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Glycoprotein Xg (XG) Antibody
20-abx318551	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Glycoprotein Xg (XG) Antibody (HRP)
20-abx305946	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Glycoprotein Xg (XG) Antibody (FITC)
20-abx305947	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Glycoprotein Xg (XG) Antibody (Biotin)
20-abx305948	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

XG Antibody
1-CSB-PA026190LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against XG. Recognizes XG from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

Glycoprotein Xg (XG) Protein
20-abx263339	Abbexa	EUR 1609.00 EUR 328.00 EUR 230.00	100 ug 10 ug 2 µg
Shipped within 5-10 working days.

XG Polyclonal Antibody, HRP Conjugated
A63805	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

XG Polyclonal Antibody, FITC Conjugated
A63806	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

XG Polyclonal Antibody, Biotin Conjugated
A63807	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

Anti-XG antibody
STJ192120	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to XG

Human Glycoprotein Xg, XG ELISA KIT
ELI-14972h	Lifescience Market	96 Tests	EUR 824

XG siRNA
20-abx939974	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-XG
YF-PA15331	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to XG

XG Antibody, HRP conjugated
1-CSB-PA026190LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against XG. Recognizes XG from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

XG Antibody, FITC conjugated
1-CSB-PA026190LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against XG. Recognizes XG from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

XG Antibody, Biotin conjugated
1-CSB-PA026190LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against XG. Recognizes XG from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

XG cloning plasmid
CSB-CL026190HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 546 Sequence: ATGGAGAGCTGGTGGGGACTTCCCTGTCTTGCGTTCCTGTGTTTTCTAATGCACGCCCGAGGTCAAAGAGACTTTGATTTGGCAGATGCCCTTGATGACCCTGAACCCACCAAGAAGCCAAACTCAGATATCTACCCAAAGCCAAAACCACCTTACTACCCACAGCCCGAGAATCC Show more
Description: A cloning plasmid for the XG gene.

XG protein (His tag)
80R-2709	Fitzgerald	20 ug	EUR 322
Description: Purified recombinant XG protein (His tag)

Human XG shRNA Plasmid
20-abx955129	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

XG Recombinant Protein (Human)
RP044887	ABM	100 ug	Ask for price

XG ORF Vector (Human) (pORF)
ORF014963	ABM	1.0 ug DNA	EUR 354

XG sgRNA CRISPR Lentivector set (Human)
K2647501	ABM	3 x 1.0 ug	EUR 339

XG Blood Group Human Recombinant Protein
PROTP55808	BosterBio	Regular: 10ug	EUR 317
Description: XG Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 144 amino acids (22-142a.a) and having a molecular mass of 15.5kDa. XG is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

XG sgRNA CRISPR Lentivector (Human) (Target 1)
K2647502	ABM	1.0 ug DNA	EUR 154

XG sgRNA CRISPR Lentivector (Human) (Target 2)
K2647503	ABM	1.0 ug DNA	EUR 154

XG sgRNA CRISPR Lentivector (Human) (Target 3)
K2647504	ABM	1.0 ug DNA	EUR 154

XG Protein Vector (Human) (pPB-C-His)
PV059849	ABM	500 ng	EUR 481

XG Protein Vector (Human) (pPB-N-His)
PV059850	ABM	500 ng	EUR 481

XG Protein Vector (Human) (pPM-C-HA)
PV059851	ABM	500 ng	EUR 481

XG Protein Vector (Human) (pPM-C-His)
PV059852	ABM	500 ng	EUR 481

Recombinant Human XG Protein, His, E.coli-100ug
QP13971-100ug	EnQuireBio	100ug	EUR 1261

Recombinant Human XG Protein, His, E.coli-10ug
QP13971-10ug	EnQuireBio	10ug	EUR 201

Recombinant Human XG Protein, His, E.coli-2ug
QP13971-2ug	EnQuireBio	2ug	EUR 155

XG 3'UTR GFP Stable Cell Line
TU078571	ABM	1.0 ml	EUR 1521

XG 3'UTR Luciferase Stable Cell Line
TU028571	ABM	1.0 ml	EUR 1521

Guinea pig Anti-Zaire+Sudan+Reston+ Bundibugyo+Marburg Glycoproteins combo IgG ELISA Kit, 96 tests, Quantitative
AE-325600-XG	Alpha Diagnostics	1 Kit	EUR 1260

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

XG Rabbit Polyclonal Antibody