YIPF3 Rabbit Polyclonal Antibody
 YIPF3 Polyclonal Antibody |
|
ES11368-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against YIPF3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 YIPF3 Antibody |
|
1-CSB-PA863928LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against YIPF3. Recognizes YIPF3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200 |
) Polyclonal YIPF3 Antibody (C-term) |
|
APR04155G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human YIPF3 (C-term). This antibody is tested and proven to work in the following applications: |
) YIPF3 Antibody (HRP) |
|
20-abx316534 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) YIPF3 Antibody (FITC) |
|
20-abx316535 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) YIPF3 Antibody (Biotin) |
|
20-abx316536 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Anti-YIPF3 Antibody |
|
PA1635 |
BosterBio |
100ug/vial |
EUR 334 |
 Anti-YIPF3 antibody |
|
STJ192526 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to YIPF3 |
 YIPF3 siRNA |
|
20-abx906124 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
YIPF3 siRNA |
|
20-abx940084 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
YIPF3 siRNA |
|
20-abx940085 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 YIPF3 Antibody, HRP conjugated |
|
1-CSB-PA863928LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against YIPF3. Recognizes YIPF3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 YIPF3 Antibody, FITC conjugated |
|
1-CSB-PA863928LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against YIPF3. Recognizes YIPF3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 YIPF3 Antibody, Biotin conjugated |
|
1-CSB-PA863928LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against YIPF3. Recognizes YIPF3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 YIPF3 cloning plasmid |
|
CSB-CL863928HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1053
- Sequence: atggcaactacagcggcgccggcgggcggcgcccgaaatggagctggcccggaatggggagggttcgaagaaaacatccagggcggaggctcagctgtgattgacatggagaacatggatgatacctcaggctctagcttcgaggatatgggtgagctgcatcagcgcctgcgcg
- Show more
|
|
Description: A cloning plasmid for the YIPF3 gene. |
 Rat YIPF3 shRNA Plasmid |
|
20-abx989112 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse YIPF3 shRNA Plasmid |
|
20-abx973953 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human YIPF3 shRNA Plasmid |
|
20-abx958539 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) YIPF3 Recombinant Protein (Rat) |
|
RP237731 |
ABM |
100 ug |
Ask for price |
) YIPF3 Recombinant Protein (Human) |
|
RP035026 |
ABM |
100 ug |
Ask for price |
) YIPF3 Recombinant Protein (Mouse) |
|
RP186029 |
ABM |
100 ug |
Ask for price |
 Antibody) YIP1 Family Member 3 (YIPF3) Antibody |
|
abx029177-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
YIP1 Family Member 3 (YIPF3) Antibody |
|
abx029177-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
YIP1 Family Member 3 (YIPF3) Antibody |
|
20-abx318259 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 (pORF)) Yipf3 ORF Vector (Mouse) (pORF) |
|
ORF062011 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Yipf3 ORF Vector (Rat) (pORF) |
|
ORF079245 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) YIPF3 ORF Vector (Human) (pORF) |
|
ORF011676 |
ABM |
1.0 ug DNA |
EUR 95 |
) Yipf3 sgRNA CRISPR Lentivector set (Rat) |
|
K7162201 |
ABM |
3 x 1.0 ug |
EUR 339 |
) YIPF3 sgRNA CRISPR Lentivector set (Human) |
|
K2654701 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Yipf3 sgRNA CRISPR Lentivector set (Mouse) |
|
K3961801 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) Yipf3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7162202 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Yipf3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7162203 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Yipf3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7162204 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) YIPF3 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2654702 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) YIPF3 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K2654703 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) YIPF3 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K2654704 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Yipf3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3961802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Yipf3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3961803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Yipf3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3961804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) YIPF3 Protein Vector (Mouse) (pPB-C-His) |
|
PV248042 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) YIPF3 Protein Vector (Mouse) (pPB-N-His) |
|
PV248043 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) YIPF3 Protein Vector (Mouse) (pPM-C-HA) |
|
PV248044 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) YIPF3 Protein Vector (Mouse) (pPM-C-His) |
|
PV248045 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) YIPF3 Protein Vector (Rat) (pPB-C-His) |
|
PV316978 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) YIPF3 Protein Vector (Rat) (pPB-N-His) |
|
PV316979 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) YIPF3 Protein Vector (Rat) (pPM-C-HA) |
|
PV316980 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) YIPF3 Protein Vector (Rat) (pPM-C-His) |
|
PV316981 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) YIPF3 Protein Vector (Human) (pPB-C-His) |
|
PV046701 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) YIPF3 Protein Vector (Human) (pPB-N-His) |
|
PV046702 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) YIPF3 Protein Vector (Human) (pPM-C-HA) |
|
PV046703 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) YIPF3 Protein Vector (Human) (pPM-C-His) |
|
PV046704 |
ABM |
500 ng |
EUR 329 |
 Yipf3 3'UTR Luciferase Stable Cell Line |
|
TU122425 |
ABM |
1.0 ml |
Ask for price |
 YIPF3 3'UTR GFP Stable Cell Line |
|
TU078646 |
ABM |
1.0 ml |
EUR 1394 |
 Yipf3 3'UTR GFP Stable Cell Line |
|
TU172425 |
ABM |
1.0 ml |
Ask for price |
Yipf3 3'UTR Luciferase Stable Cell Line |
|
TU223510 |
ABM |
1.0 ml |
Ask for price |
 YIPF3 3'UTR Luciferase Stable Cell Line |
|
TU028646 |
ABM |
1.0 ml |
EUR 1394 |
Yipf3 3'UTR GFP Stable Cell Line |
|
TU273510 |
ABM |
1.0 ml |
Ask for price |
 (CMV) (pLenti-GIII-CMV)) YIPF3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV689827 |
ABM |
1.0 ug DNA |
EUR 682 |
 (UbC) (pLenti-GIII-UbC)) YIPF3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV689831 |
ABM |
1.0 ug DNA |
EUR 682 |
 (EF1a) (pLenti-GIII-EF1a)) YIPF3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV689832 |
ABM |
1.0 ug DNA |
EUR 682 |
 (UbC) (pLenti-GIII-UbC)) YIPF3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
|
LV793261 |
ABM |
1.0 ug DNA |
EUR 316 |
 (EF1a) (pLenti-GIII-EF1a)) YIPF3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
|
LV793262 |
ABM |
1.0 ug DNA |
EUR 316 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
 NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
YIPF3 Rabbit Polyclonal Antibody
