CelltaGen

셀타젠 Genetic Genotyping

YIPF3 Rabbit Polyclonal Antibody

YIPF3 Rabbit Polyclonal Antibody

YIPF3 Polyclonal Antibody

ES11368-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against YIPF3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

YIPF3 Antibody

1-CSB-PA863928LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against YIPF3. Recognizes YIPF3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

Polyclonal YIPF3 Antibody (C-term)

APR04155G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human YIPF3 (C-term). This antibody is tested and proven to work in the following applications:

Yipf3/ Rat Yipf3 ELISA Kit

ELI-28778r 96 Tests
EUR 886

YIPF3 Antibody (HRP)

20-abx316534
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

YIPF3 Antibody (FITC)

20-abx316535
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

YIPF3 Antibody (Biotin)

20-abx316536
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-YIPF3 Antibody

PA1635 100ug/vial
EUR 334

Anti-YIPF3 antibody

STJ192526 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to YIPF3

Human Protein YIPF3, YIPF3 ELISA KIT

ELI-28792h 96 Tests
EUR 824

Mouse Protein YIPF3, Yipf3 ELISA KIT

ELI-44251m 96 Tests
EUR 865

Chicken Protein YIPF3, YIPF3 ELISA KIT

ELI-35242c 96 Tests
EUR 928

YIPF3 siRNA

20-abx906124
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

YIPF3 siRNA

20-abx940084
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

YIPF3 siRNA

20-abx940085
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

YIPF3 Antibody, HRP conjugated

1-CSB-PA863928LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against YIPF3. Recognizes YIPF3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

YIPF3 Antibody, FITC conjugated

1-CSB-PA863928LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against YIPF3. Recognizes YIPF3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

YIPF3 Antibody, Biotin conjugated

1-CSB-PA863928LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against YIPF3. Recognizes YIPF3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

YIPF3 cloning plasmid

CSB-CL863928HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1053
  • Sequence: atggcaactacagcggcgccggcgggcggcgcccgaaatggagctggcccggaatggggagggttcgaagaaaacatccagggcggaggctcagctgtgattgacatggagaacatggatgatacctcaggctctagcttcgaggatatgggtgagctgcatcagcgcctgcgcg
  • Show more
Description: A cloning plasmid for the YIPF3 gene.

Rat YIPF3 shRNA Plasmid

20-abx989112
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse YIPF3 shRNA Plasmid

20-abx973953
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human YIPF3 shRNA Plasmid

20-abx958539
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

YIPF3 Recombinant Protein (Rat)

RP237731 100 ug Ask for price

YIPF3 Recombinant Protein (Human)

RP035026 100 ug Ask for price

YIPF3 Recombinant Protein (Mouse)

RP186029 100 ug Ask for price

YIP1 Family Member 3 (YIPF3) Antibody

abx029177-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

YIP1 Family Member 3 (YIPF3) Antibody

abx029177-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

YIP1 Family Member 3 (YIPF3) Antibody

20-abx318259
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Yipf3 ORF Vector (Mouse) (pORF)

ORF062011 1.0 ug DNA
EUR 506

Yipf3 ORF Vector (Rat) (pORF)

ORF079245 1.0 ug DNA
EUR 506

YIPF3 ORF Vector (Human) (pORF)

ORF011676 1.0 ug DNA
EUR 95

Yipf3 sgRNA CRISPR Lentivector set (Rat)

K7162201 3 x 1.0 ug
EUR 339

YIPF3 sgRNA CRISPR Lentivector set (Human)

K2654701 3 x 1.0 ug
EUR 339

Yipf3 sgRNA CRISPR Lentivector set (Mouse)

K3961801 3 x 1.0 ug
EUR 339

Yipf3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7162202 1.0 ug DNA
EUR 154

Yipf3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7162203 1.0 ug DNA
EUR 154

Yipf3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7162204 1.0 ug DNA
EUR 154

YIPF3 sgRNA CRISPR Lentivector (Human) (Target 1)

K2654702 1.0 ug DNA
EUR 154

YIPF3 sgRNA CRISPR Lentivector (Human) (Target 2)

K2654703 1.0 ug DNA
EUR 154

YIPF3 sgRNA CRISPR Lentivector (Human) (Target 3)

K2654704 1.0 ug DNA
EUR 154

Yipf3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3961802 1.0 ug DNA
EUR 154

Yipf3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3961803 1.0 ug DNA
EUR 154

Yipf3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3961804 1.0 ug DNA
EUR 154

YIPF3 Protein Vector (Mouse) (pPB-C-His)

PV248042 500 ng
EUR 603

YIPF3 Protein Vector (Mouse) (pPB-N-His)

PV248043 500 ng
EUR 603

YIPF3 Protein Vector (Mouse) (pPM-C-HA)

PV248044 500 ng
EUR 603

YIPF3 Protein Vector (Mouse) (pPM-C-His)

PV248045 500 ng
EUR 603

YIPF3 Protein Vector (Rat) (pPB-C-His)

PV316978 500 ng
EUR 603

YIPF3 Protein Vector (Rat) (pPB-N-His)

PV316979 500 ng
EUR 603

YIPF3 Protein Vector (Rat) (pPM-C-HA)

PV316980 500 ng
EUR 603

YIPF3 Protein Vector (Rat) (pPM-C-His)

PV316981 500 ng
EUR 603

YIPF3 Protein Vector (Human) (pPB-C-His)

PV046701 500 ng
EUR 329

YIPF3 Protein Vector (Human) (pPB-N-His)

PV046702 500 ng
EUR 329

YIPF3 Protein Vector (Human) (pPM-C-HA)

PV046703 500 ng
EUR 329

YIPF3 Protein Vector (Human) (pPM-C-His)

PV046704 500 ng
EUR 329

Yipf3 3'UTR Luciferase Stable Cell Line

TU122425 1.0 ml Ask for price

YIPF3 3'UTR GFP Stable Cell Line

TU078646 1.0 ml
EUR 1394

Yipf3 3'UTR GFP Stable Cell Line

TU172425 1.0 ml Ask for price

Yipf3 3'UTR Luciferase Stable Cell Line

TU223510 1.0 ml Ask for price

YIPF3 3'UTR Luciferase Stable Cell Line

TU028646 1.0 ml
EUR 1394

Yipf3 3'UTR GFP Stable Cell Line

TU273510 1.0 ml Ask for price

YIPF3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV689827 1.0 ug DNA
EUR 682

YIPF3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV689831 1.0 ug DNA
EUR 682

YIPF3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV689832 1.0 ug DNA
EUR 682

YIPF3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV793261 1.0 ug DNA
EUR 316

YIPF3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV793262 1.0 ug DNA
EUR 316

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

YIPF3 Rabbit Polyclonal Antibody