CelltaGen
셀타젠 Genetic Genotyping

YIPF3 Rabbit Polyclonal Antibody

YIPF3 Polyclonal Antibody

ABP60944-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human YIPF3 protein at amino acid sequence of N-terminal
  • Applications tips:
Description: A polyclonal antibody for detection of YIPF3 from Human, Mouse, Rat. This YIPF3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human YIPF3 protein at amino acid sequence of N-terminal

YIPF3 Antibody

1-CSB-PA863928LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against YIPF3. Recognizes YIPF3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

Polyclonal YIPF3 Antibody (C-term)

APR04155G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human YIPF3 (C-term). This antibody is tested and proven to work in the following applications:

Yipf3/ Rat Yipf3 ELISA Kit

ELI-28778r 96 Tests
EUR 886

YIPF3 Antibody (HRP)

20-abx316534
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

YIPF3 Antibody (FITC)

20-abx316535
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

YIPF3 Antibody (Biotin)

20-abx316536
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-YIPF3 Antibody

PA1635 100ug/vial
EUR 334

Anti-YIPF3 antibody

STJ192526 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to YIPF3

Chicken Protein YIPF3, YIPF3 ELISA KIT

ELI-35242c 96 Tests
EUR 928

Mouse Protein YIPF3, Yipf3 ELISA KIT

ELI-44251m 96 Tests
EUR 865

Human Protein YIPF3, YIPF3 ELISA KIT

ELI-28792h 96 Tests
EUR 824

YIPF3 siRNA

20-abx906124
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

YIPF3 siRNA

20-abx940084
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

YIPF3 siRNA

20-abx940085
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

YIPF3 Antibody, HRP conjugated

1-CSB-PA863928LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against YIPF3. Recognizes YIPF3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

YIPF3 Antibody, FITC conjugated

1-CSB-PA863928LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against YIPF3. Recognizes YIPF3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

YIPF3 Antibody, Biotin conjugated

1-CSB-PA863928LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against YIPF3. Recognizes YIPF3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

YIPF3 cloning plasmid

CSB-CL863928HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1053
  • Sequence: atggcaactacagcggcgccggcgggcggcgcccgaaatggagctggcccggaatggggagggttcgaagaaaacatccagggcggaggctcagctgtgattgacatggagaacatggatgatacctcaggctctagcttcgaggatatgggtgagctgcatcagcgcctgcgcg
  • Show more
Description: A cloning plasmid for the YIPF3 gene.

Mouse YIPF3 shRNA Plasmid

20-abx973953
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat YIPF3 shRNA Plasmid

20-abx989112
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human YIPF3 shRNA Plasmid

20-abx958539
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

YIPF3 Recombinant Protein (Human)

RP035026 100 ug Ask for price

YIPF3 Recombinant Protein (Rat)

RP237731 100 ug Ask for price

YIPF3 Recombinant Protein (Mouse)

RP186029 100 ug Ask for price

YIP1 Family Member 3 (YIPF3) Antibody

abx029177-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

YIP1 Family Member 3 (YIPF3) Antibody

abx029177-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

YIP1 Family Member 3 (YIPF3) Antibody

20-abx318259
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Yipf3 ORF Vector (Rat) (pORF)

ORF079245 1.0 ug DNA
EUR 506

YIPF3 ORF Vector (Human) (pORF)

ORF011676 1.0 ug DNA
EUR 95

Yipf3 ORF Vector (Mouse) (pORF)

ORF062011 1.0 ug DNA
EUR 506

YIPF3 sgRNA CRISPR Lentivector set (Human)

K2654701 3 x 1.0 ug
EUR 339

Yipf3 sgRNA CRISPR Lentivector set (Mouse)

K3961801 3 x 1.0 ug
EUR 339

Yipf3 sgRNA CRISPR Lentivector set (Rat)

K7162201 3 x 1.0 ug
EUR 339

YIPF3 sgRNA CRISPR Lentivector (Human) (Target 1)

K2654702 1.0 ug DNA
EUR 154

YIPF3 sgRNA CRISPR Lentivector (Human) (Target 2)

K2654703 1.0 ug DNA
EUR 154

YIPF3 sgRNA CRISPR Lentivector (Human) (Target 3)

K2654704 1.0 ug DNA
EUR 154

Yipf3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3961802 1.0 ug DNA
EUR 154

Yipf3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3961803 1.0 ug DNA
EUR 154

Yipf3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3961804 1.0 ug DNA
EUR 154

Yipf3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7162202 1.0 ug DNA
EUR 154

Yipf3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7162203 1.0 ug DNA
EUR 154

Yipf3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7162204 1.0 ug DNA
EUR 154

YIPF3 Protein Vector (Human) (pPB-C-His)

PV046701 500 ng
EUR 329

YIPF3 Protein Vector (Human) (pPB-N-His)

PV046702 500 ng
EUR 329

YIPF3 Protein Vector (Human) (pPM-C-HA)

PV046703 500 ng
EUR 329

YIPF3 Protein Vector (Human) (pPM-C-His)

PV046704 500 ng
EUR 329

YIPF3 Protein Vector (Rat) (pPB-C-His)

PV316978 500 ng
EUR 603

YIPF3 Protein Vector (Rat) (pPB-N-His)

PV316979 500 ng
EUR 603

YIPF3 Protein Vector (Rat) (pPM-C-HA)

PV316980 500 ng
EUR 603

YIPF3 Protein Vector (Rat) (pPM-C-His)

PV316981 500 ng
EUR 603

YIPF3 Protein Vector (Mouse) (pPB-C-His)

PV248042 500 ng
EUR 603

YIPF3 Protein Vector (Mouse) (pPB-N-His)

PV248043 500 ng
EUR 603

YIPF3 Protein Vector (Mouse) (pPM-C-HA)

PV248044 500 ng
EUR 603

YIPF3 Protein Vector (Mouse) (pPM-C-His)

PV248045 500 ng
EUR 603

Yipf3 3'UTR GFP Stable Cell Line

TU172425 1.0 ml Ask for price

YIPF3 3'UTR GFP Stable Cell Line

TU078646 1.0 ml
EUR 1394

Yipf3 3'UTR Luciferase Stable Cell Line

TU122425 1.0 ml Ask for price

YIPF3 3'UTR Luciferase Stable Cell Line

TU028646 1.0 ml
EUR 1394

Yipf3 3'UTR Luciferase Stable Cell Line

TU223510 1.0 ml Ask for price

Yipf3 3'UTR GFP Stable Cell Line

TU273510 1.0 ml Ask for price

YIPF3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV689827 1.0 ug DNA
EUR 682

YIPF3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV689831 1.0 ug DNA
EUR 682

YIPF3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV689832 1.0 ug DNA
EUR 682

YIPF3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV793261 1.0 ug DNA
EUR 316

YIPF3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV793262 1.0 ug DNA
EUR 316

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

YIPF3 Rabbit Polyclonal Antibody