YIPF3 Rabbit Polyclonal Antibody
 YIPF3 Polyclonal Antibody |
|
ABP60944-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human YIPF3 protein at amino acid sequence of N-terminal
- Applications tips:
|
|
Description: A polyclonal antibody for detection of YIPF3 from Human, Mouse, Rat. This YIPF3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human YIPF3 protein at amino acid sequence of N-terminal |
 YIPF3 Antibody |
|
1-CSB-PA863928LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against YIPF3. Recognizes YIPF3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200 |
) Polyclonal YIPF3 Antibody (C-term) |
|
APR04155G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human YIPF3 (C-term). This antibody is tested and proven to work in the following applications: |
) YIPF3 Antibody (HRP) |
|
20-abx316534 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) YIPF3 Antibody (FITC) |
|
20-abx316535 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) YIPF3 Antibody (Biotin) |
|
20-abx316536 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Anti-YIPF3 Antibody |
|
PA1635 |
BosterBio |
100ug/vial |
EUR 334 |
 Anti-YIPF3 antibody |
|
STJ192526 |
St John's Laboratory |
200 ยตl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to YIPF3 |
 YIPF3 siRNA |
|
20-abx906124 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
YIPF3 siRNA |
|
20-abx940084 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
YIPF3 siRNA |
|
20-abx940085 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 YIPF3 Antibody, HRP conjugated |
|
1-CSB-PA863928LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against YIPF3. Recognizes YIPF3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 YIPF3 Antibody, FITC conjugated |
|
1-CSB-PA863928LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against YIPF3. Recognizes YIPF3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 YIPF3 Antibody, Biotin conjugated |
|
1-CSB-PA863928LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against YIPF3. Recognizes YIPF3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 YIPF3 cloning plasmid |
|
CSB-CL863928HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 รยผg plasmid + 200รยผl Glycerol
- Length: 1053
- Sequence: atggcaactacagcggcgccggcgggcggcgcccgaaatggagctggcccggaatggggagggttcgaagaaaacatccagggcggaggctcagctgtgattgacatggagaacatggatgatacctcaggctctagcttcgaggatatgggtgagctgcatcagcgcctgcgcg
- Show more
|
|
Description: A cloning plasmid for the YIPF3 gene. |
 Mouse YIPF3 shRNA Plasmid |
|
20-abx973953 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Rat YIPF3 shRNA Plasmid |
|
20-abx989112 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human YIPF3 shRNA Plasmid |
|
20-abx958539 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) YIPF3 Recombinant Protein (Human) |
|
RP035026 |
ABM |
100 ug |
Ask for price |
) YIPF3 Recombinant Protein (Rat) |
|
RP237731 |
ABM |
100 ug |
Ask for price |
) YIPF3 Recombinant Protein (Mouse) |
|
RP186029 |
ABM |
100 ug |
Ask for price |
 Antibody) YIP1 Family Member 3 (YIPF3) Antibody |
|
abx029177-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
YIP1 Family Member 3 (YIPF3) Antibody |
|
abx029177-80l |
Abbexa |
80 ยตl |
EUR 286 |
- Shipped within 5-10 working days.
|
YIP1 Family Member 3 (YIPF3) Antibody |
|
20-abx318259 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 (pORF)) Yipf3 ORF Vector (Rat) (pORF) |
|
ORF079245 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) YIPF3 ORF Vector (Human) (pORF) |
|
ORF011676 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Yipf3 ORF Vector (Mouse) (pORF) |
|
ORF062011 |
ABM |
1.0 ug DNA |
EUR 506 |
) YIPF3 sgRNA CRISPR Lentivector set (Human) |
|
K2654701 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Yipf3 sgRNA CRISPR Lentivector set (Mouse) |
|
K3961801 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Yipf3 sgRNA CRISPR Lentivector set (Rat) |
|
K7162201 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) YIPF3 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2654702 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) YIPF3 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K2654703 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) YIPF3 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K2654704 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Yipf3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3961802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Yipf3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3961803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Yipf3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3961804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Yipf3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7162202 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Yipf3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7162203 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Yipf3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7162204 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) YIPF3 Protein Vector (Human) (pPB-C-His) |
|
PV046701 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) YIPF3 Protein Vector (Human) (pPB-N-His) |
|
PV046702 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) YIPF3 Protein Vector (Human) (pPM-C-HA) |
|
PV046703 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) YIPF3 Protein Vector (Human) (pPM-C-His) |
|
PV046704 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) YIPF3 Protein Vector (Rat) (pPB-C-His) |
|
PV316978 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) YIPF3 Protein Vector (Rat) (pPB-N-His) |
|
PV316979 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) YIPF3 Protein Vector (Rat) (pPM-C-HA) |
|
PV316980 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) YIPF3 Protein Vector (Rat) (pPM-C-His) |
|
PV316981 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) YIPF3 Protein Vector (Mouse) (pPB-C-His) |
|
PV248042 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) YIPF3 Protein Vector (Mouse) (pPB-N-His) |
|
PV248043 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) YIPF3 Protein Vector (Mouse) (pPM-C-HA) |
|
PV248044 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) YIPF3 Protein Vector (Mouse) (pPM-C-His) |
|
PV248045 |
ABM |
500 ng |
EUR 603 |
 Yipf3 3'UTR GFP Stable Cell Line |
|
TU172425 |
ABM |
1.0 ml |
Ask for price |
 YIPF3 3'UTR GFP Stable Cell Line |
|
TU078646 |
ABM |
1.0 ml |
EUR 1394 |
 Yipf3 3'UTR Luciferase Stable Cell Line |
|
TU122425 |
ABM |
1.0 ml |
Ask for price |
 YIPF3 3'UTR Luciferase Stable Cell Line |
|
TU028646 |
ABM |
1.0 ml |
EUR 1394 |
Yipf3 3'UTR Luciferase Stable Cell Line |
|
TU223510 |
ABM |
1.0 ml |
Ask for price |
Yipf3 3'UTR GFP Stable Cell Line |
|
TU273510 |
ABM |
1.0 ml |
Ask for price |
 (CMV) (pLenti-GIII-CMV)) YIPF3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV689827 |
ABM |
1.0 ug DNA |
EUR 682 |
 (UbC) (pLenti-GIII-UbC)) YIPF3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV689831 |
ABM |
1.0 ug DNA |
EUR 682 |
 (EF1a) (pLenti-GIII-EF1a)) YIPF3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV689832 |
ABM |
1.0 ug DNA |
EUR 682 |
 (UbC) (pLenti-GIII-UbC)) YIPF3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
|
LV793261 |
ABM |
1.0 ug DNA |
EUR 316 |
 (EF1a) (pLenti-GIII-EF1a)) YIPF3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
|
LV793262 |
ABM |
1.0 ug DNA |
EUR 316 |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
YIPF3 Rabbit Polyclonal Antibody
