YIPF3 Rabbit Polyclonal Antibody
YIPF3 Polyclonal Antibody |
ES11368-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against YIPF3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
YIPF3 Antibody |
1-CSB-PA863928LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against YIPF3. Recognizes YIPF3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200 |
Polyclonal YIPF3 Antibody (C-term) |
APR04155G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human YIPF3 (C-term). This antibody is tested and proven to work in the following applications: |
YIPF3 Antibody (HRP) |
20-abx316534 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
YIPF3 Antibody (FITC) |
20-abx316535 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
YIPF3 Antibody (Biotin) |
20-abx316536 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-YIPF3 Antibody |
PA1635 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-YIPF3 antibody |
STJ192526 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to YIPF3 |
YIPF3 siRNA |
20-abx906124 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
YIPF3 siRNA |
20-abx940084 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
YIPF3 siRNA |
20-abx940085 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
YIPF3 Antibody, HRP conjugated |
1-CSB-PA863928LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against YIPF3. Recognizes YIPF3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
YIPF3 Antibody, FITC conjugated |
1-CSB-PA863928LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against YIPF3. Recognizes YIPF3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
YIPF3 Antibody, Biotin conjugated |
1-CSB-PA863928LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against YIPF3. Recognizes YIPF3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
YIPF3 cloning plasmid |
CSB-CL863928HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1053
- Sequence: atggcaactacagcggcgccggcgggcggcgcccgaaatggagctggcccggaatggggagggttcgaagaaaacatccagggcggaggctcagctgtgattgacatggagaacatggatgatacctcaggctctagcttcgaggatatgggtgagctgcatcagcgcctgcgcg
- Show more
|
Description: A cloning plasmid for the YIPF3 gene. |
Rat YIPF3 shRNA Plasmid |
20-abx989112 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse YIPF3 shRNA Plasmid |
20-abx973953 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human YIPF3 shRNA Plasmid |
20-abx958539 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
YIPF3 Recombinant Protein (Rat) |
RP237731 |
ABM |
100 ug |
Ask for price |
YIPF3 Recombinant Protein (Human) |
RP035026 |
ABM |
100 ug |
Ask for price |
YIPF3 Recombinant Protein (Mouse) |
RP186029 |
ABM |
100 ug |
Ask for price |
YIP1 Family Member 3 (YIPF3) Antibody |
abx029177-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
YIP1 Family Member 3 (YIPF3) Antibody |
abx029177-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
YIP1 Family Member 3 (YIPF3) Antibody |
20-abx318259 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Yipf3 ORF Vector (Mouse) (pORF) |
ORF062011 |
ABM |
1.0 ug DNA |
EUR 506 |
Yipf3 ORF Vector (Rat) (pORF) |
ORF079245 |
ABM |
1.0 ug DNA |
EUR 506 |
YIPF3 ORF Vector (Human) (pORF) |
ORF011676 |
ABM |
1.0 ug DNA |
EUR 95 |
Yipf3 sgRNA CRISPR Lentivector set (Rat) |
K7162201 |
ABM |
3 x 1.0 ug |
EUR 339 |
YIPF3 sgRNA CRISPR Lentivector set (Human) |
K2654701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Yipf3 sgRNA CRISPR Lentivector set (Mouse) |
K3961801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Yipf3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7162202 |
ABM |
1.0 ug DNA |
EUR 154 |
Yipf3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7162203 |
ABM |
1.0 ug DNA |
EUR 154 |
Yipf3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7162204 |
ABM |
1.0 ug DNA |
EUR 154 |
YIPF3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2654702 |
ABM |
1.0 ug DNA |
EUR 154 |
YIPF3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2654703 |
ABM |
1.0 ug DNA |
EUR 154 |
YIPF3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2654704 |
ABM |
1.0 ug DNA |
EUR 154 |
Yipf3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3961802 |
ABM |
1.0 ug DNA |
EUR 154 |
Yipf3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3961803 |
ABM |
1.0 ug DNA |
EUR 154 |
Yipf3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3961804 |
ABM |
1.0 ug DNA |
EUR 154 |
YIPF3 Protein Vector (Mouse) (pPB-C-His) |
PV248042 |
ABM |
500 ng |
EUR 603 |
YIPF3 Protein Vector (Mouse) (pPB-N-His) |
PV248043 |
ABM |
500 ng |
EUR 603 |
YIPF3 Protein Vector (Mouse) (pPM-C-HA) |
PV248044 |
ABM |
500 ng |
EUR 603 |
YIPF3 Protein Vector (Mouse) (pPM-C-His) |
PV248045 |
ABM |
500 ng |
EUR 603 |
YIPF3 Protein Vector (Rat) (pPB-C-His) |
PV316978 |
ABM |
500 ng |
EUR 603 |
YIPF3 Protein Vector (Rat) (pPB-N-His) |
PV316979 |
ABM |
500 ng |
EUR 603 |
YIPF3 Protein Vector (Rat) (pPM-C-HA) |
PV316980 |
ABM |
500 ng |
EUR 603 |
YIPF3 Protein Vector (Rat) (pPM-C-His) |
PV316981 |
ABM |
500 ng |
EUR 603 |
YIPF3 Protein Vector (Human) (pPB-C-His) |
PV046701 |
ABM |
500 ng |
EUR 329 |
YIPF3 Protein Vector (Human) (pPB-N-His) |
PV046702 |
ABM |
500 ng |
EUR 329 |
YIPF3 Protein Vector (Human) (pPM-C-HA) |
PV046703 |
ABM |
500 ng |
EUR 329 |
YIPF3 Protein Vector (Human) (pPM-C-His) |
PV046704 |
ABM |
500 ng |
EUR 329 |
Yipf3 3'UTR Luciferase Stable Cell Line |
TU122425 |
ABM |
1.0 ml |
Ask for price |
YIPF3 3'UTR GFP Stable Cell Line |
TU078646 |
ABM |
1.0 ml |
EUR 1394 |
Yipf3 3'UTR GFP Stable Cell Line |
TU172425 |
ABM |
1.0 ml |
Ask for price |
Yipf3 3'UTR Luciferase Stable Cell Line |
TU223510 |
ABM |
1.0 ml |
Ask for price |
YIPF3 3'UTR Luciferase Stable Cell Line |
TU028646 |
ABM |
1.0 ml |
EUR 1394 |
Yipf3 3'UTR GFP Stable Cell Line |
TU273510 |
ABM |
1.0 ml |
Ask for price |
YIPF3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV689827 |
ABM |
1.0 ug DNA |
EUR 682 |
YIPF3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV689831 |
ABM |
1.0 ug DNA |
EUR 682 |
YIPF3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV689832 |
ABM |
1.0 ug DNA |
EUR 682 |
YIPF3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV793261 |
ABM |
1.0 ug DNA |
EUR 316 |
YIPF3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV793262 |
ABM |
1.0 ug DNA |
EUR 316 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
YIPF3 Rabbit Polyclonal Antibody