ZBP1 Rabbit Polyclonal Antibody

ZBP1 Rabbit Polyclonal Antibody

ZBP1 Polyclonal Antibody
ABP60951-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human ZBP1 protein at amino acid sequence of 21-70
  • Applications tips:
Description: A polyclonal antibody for detection of ZBP1 from Human. This ZBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ZBP1 protein at amino acid sequence of 21-70

ZBP1 Polyclonal Antibody
ABP60951-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ZBP1 protein at amino acid sequence of 21-70
  • Applications tips:
Description: A polyclonal antibody for detection of ZBP1 from Human. This ZBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ZBP1 protein at amino acid sequence of 21-70

ZBP1 Polyclonal Antibody
ABP60951-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ZBP1 protein at amino acid sequence of 21-70
  • Applications tips:
Description: A polyclonal antibody for detection of ZBP1 from Human. This ZBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ZBP1 protein at amino acid sequence of 21-70

ZBP1 Polyclonal Antibody
ES11422-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ZBP1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

ZBP1 Polyclonal Antibody
ES11422-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ZBP1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

ZBP1 Rabbit pAb
A13899-100ul 100 ul
EUR 308

ZBP1 Rabbit pAb
A13899-200ul 200 ul
EUR 459

ZBP1 Rabbit pAb
A13899-20ul 20 ul
EUR 183

ZBP1 Rabbit pAb
A13899-50ul 50 ul
EUR 223

ZBP1 Polyclonal Conjugated Antibody
C28403 100ul
EUR 397

ZBP1 Antibody
24608-100ul 100ul
EUR 390

ZBP1 antibody
70R-1257 100 ug
EUR 377
Description: Rabbit polyclonal ZBP1 antibody raised against the middle region of ZBP1

ZBP1 antibody
70R-21368 50 ul
EUR 435
Description: Rabbit polyclonal ZBP1 antibody

ZBP1 Antibody
1-CSB-PA026311GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ZBP1. Recognizes ZBP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Rabbit ZBP1 ELISA Kit
ERTZ0008 96Tests
EUR 521

Zbp1/ Rat Zbp1 ELISA Kit
ELI-40534r 96 Tests
EUR 886

anti- ZBP1 antibody
FNab09586 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200
  • Immunogen: Z-DNA binding protein 1
  • Uniprot ID: Q9H171
  • Gene ID: 81030
Description: Antibody raised against ZBP1

Anti-ZBP1 antibody
PAab09586 100 ug
EUR 412

Anti-ZBP1 antibody
STJ115838 100 µl
EUR 277
Description: This gene encodes a Z-DNA binding protein. The encoded protein plays a role in the innate immune response by binding to foreign DNA and inducing type-I interferon production. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Anti-ZBP1 antibody
STJ192580 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ZBP1

ZBP1 siRNA
20-abx940166
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ZBP1 siRNA
20-abx940167
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-IMP1 / ZBP1 antibody
STJ72253 100 µg
EUR 359

ZBP1 cloning plasmid
CSB-CL861990HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 450
  • Sequence: atggcccaggctcctgctgacccgggcagagaaggccaccttgaacaaagaatcctgcaggtgctgacagaggctggctccccggtgaaacttgcccagctggtgaaggaatgccaagcacccaagagggagctcaaccaagtcctctaccgaatgaaaaaggagttgaaagtctc
  • Show more
Description: A cloning plasmid for the ZBP1 gene.

ZBP1 cloning plasmid
CSB-CL861990HU2-10ug 10ug
EUR 471
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1290
  • Sequence: ATGGCCCAGGCTCCTGCTGACCCGGGCAGAGAAGGCCACCTTGAACAAAGAATCCTGCAGGTGCTGACAGAGGCTGGCTCCCCGGTGAAACTTGCCCAGCTGGTGAAGGAATGCCAAGCACCCAAGAGGGAGCTCAACCAAGTCCTCTACCGAATGAAAAAGGAGTTGAAAGTCT
  • Show more
Description: A cloning plasmid for the ZBP1 gene.

Z-DNA Binding Protein 1 (ZBP1) Polyclonal Antibody (Human)
4-PAB552Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZBP1 (Arg10~Pro167)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Z-DNA Binding Protein 1 (ZBP1)

Human ZBP1 ELISA Kit
EHZ0008 96Tests
EUR 521

Bovine ZBP1 ELISA Kit
EBZ0008 96Tests
EUR 521

Anserini ZBP1 ELISA Kit
EAZ0008 96Tests
EUR 521

Chicken ZBP1 ELISA Kit
ECKZ0008 96Tests
EUR 521

Canine ZBP1 ELISA Kit
ECZ0008 96Tests
EUR 521

Goat ZBP1 ELISA Kit
EGTZ0008 96Tests
EUR 521

ZBP1 ELISA KIT|Human
EF004355 96 Tests
EUR 689

Mouse ZBP1 shRNA Plasmid
20-abx975072
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ZBP1 shRNA Plasmid
20-abx962944
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Sheep ZBP1 ELISA Kit
ESZ0008 96Tests
EUR 521

Porcine ZBP1 ELISA Kit
EPZ0008 96Tests
EUR 521

Rat ZBP1 ELISA Kit
ERZ0008 96Tests
EUR 521

Monkey ZBP1 ELISA Kit
EMKZ0008 96Tests
EUR 521

Mouse ZBP1 ELISA Kit
EMZ0008 96Tests
EUR 521

pCMV-SPORT6-ZBP1 Plasmid
PVT16562 2 ug
EUR 325

pEGFP-N1-FLAG-ZBP1
PVT17949 2 ug
EUR 258

pCR-BluntII-TOPO-ZBP1
PVT17971 2 ug
EUR 231

pmCherry-N1-Myc-ZBP1
PVT18072 2 ug
EUR 258

ZBP1 Recombinant Protein (Human)
RP044914 100 ug Ask for price

ZBP1 Recombinant Protein (Human)
RP035122 100 ug Ask for price

ZBP1 Recombinant Protein (Mouse)
RP186158 100 ug Ask for price

ZBP1 Recombinant Protein (Mouse)
RP186161 100 ug Ask for price

Z-DNA Binding Protein 1 (ZBP1) Polyclonal Antibody (Human), APC
4-PAB552Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZBP1 (Arg10~Pro167)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Z-DNA Binding Protein 1 (ZBP1). This antibody is labeled with APC.

Z-DNA Binding Protein 1 (ZBP1) Polyclonal Antibody (Human), Biotinylated
4-PAB552Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZBP1 (Arg10~Pro167)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Z-DNA Binding Protein 1 (ZBP1). This antibody is labeled with Biotin.

Z-DNA Binding Protein 1 (ZBP1) Polyclonal Antibody (Human), Cy3
4-PAB552Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZBP1 (Arg10~Pro167)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Z-DNA Binding Protein 1 (ZBP1). This antibody is labeled with Cy3.

Z-DNA Binding Protein 1 (ZBP1) Polyclonal Antibody (Human), FITC
4-PAB552Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZBP1 (Arg10~Pro167)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Z-DNA Binding Protein 1 (ZBP1). This antibody is labeled with FITC.

Z-DNA Binding Protein 1 (ZBP1) Polyclonal Antibody (Human), HRP
4-PAB552Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZBP1 (Arg10~Pro167)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Z-DNA Binding Protein 1 (ZBP1). This antibody is labeled with HRP.

Z-DNA Binding Protein 1 (ZBP1) Polyclonal Antibody (Human), PE
4-PAB552Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZBP1 (Arg10~Pro167)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Z-DNA Binding Protein 1 (ZBP1). This antibody is labeled with PE.

Z-DNA Binding Protein 1 (ZBP1) Polyclonal Antibody (Human), APC-Cy7
4-PAB552Hu01-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZBP1 (Arg10~Pro167)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Z-DNA Binding Protein 1 (ZBP1). This antibody is labeled with APC-Cy7.

Z-DNA-Binding Protein 1 (ZBP1) Antibody
20-abx003826
  • EUR 495.00
  • EUR 356.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Z-DNA Binding Protein 1 (ZBP1) Antibody
20-abx102404
  • EUR 300.00
  • EUR 133.00
  • EUR 787.00
  • EUR 411.00
  • EUR 258.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Z-Dna Binding Protein 1 (ZBP1) Antibody
20-abx116709
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Z-DNA-Binding Protein 1 (ZBP1) Antibody
abx239586-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Z-DNA-Binding Protein 1 (ZBP1) Antibody
abx412058-01mg 0.1 mg
EUR 537
  • Shipped within 1 week.

Z-DNA-Binding Protein 1 (ZBP1) Antibody
abx412059-50ug 50 ug
EUR 356
  • Shipped within 1 week.

Z-DNA-Binding Protein 1 (ZBP1) Antibody
abx430069-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Guinea Pig ZBP1 ELISA Kit
EGZ0008 96Tests
EUR 521

Zbp1 ORF Vector (Mouse) (pORF)
ORF062054 1.0 ug DNA
EUR 506

Zbp1 ORF Vector (Mouse) (pORF)
ORF062055 1.0 ug DNA
EUR 506

ZBP1 ORF Vector (Human) (pORF)
ORF011708 1.0 ug DNA
EUR 95

ZBP1 ORF Vector (Human) (pORF)
ORF014972 1.0 ug DNA
EUR 354

ZBP1 Western Blot kit (AWBK36711)
AWBK36711 10 reactions
EUR 647
Description:
  • Description of target:
  • Species reactivity:
  • Application:
  • Assay info:
  • Sensitivity:

ZBP1 ELISA Kit (Human) (OKCA00862)
OKCA00862 96 Wells
EUR 833
Description: Description of target: Participates in the detection by the host's innate immune system of DNA from viral, bacterial or even host origin. Plays a role in host defense against tumors and pathogens. Acts as a cytoplasmic DNA sensor which, when activated, induces the recruitment of TBK1 and IRF3 to its C-terminal region and activates the downstream interferon regulatory factor (IRF) and NF-kappa B transcription factors, leading to type-I interferon production. ZBP1-induced NF-kappaB activation probably involves the recruitment of the RHIM containing kinases RIPK1 and RIPK3.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.86 pg/mL

ZBP1 sgRNA CRISPR Lentivector set (Human)
K2660101 3 x 1.0 ug
EUR 339

Zbp1 sgRNA CRISPR Lentivector set (Mouse)
K4373001 3 x 1.0 ug
EUR 339

ZBP1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2660102 1.0 ug DNA
EUR 154

ZBP1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2660103 1.0 ug DNA
EUR 154

ZBP1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2660104 1.0 ug DNA
EUR 154

Zbp1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4373002 1.0 ug DNA
EUR 154

Zbp1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4373003 1.0 ug DNA
EUR 154

Zbp1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4373004 1.0 ug DNA
EUR 154

ZBP1 Protein Vector (Mouse) (pPB-C-His)
PV248214 500 ng
EUR 603

ZBP1 Protein Vector (Mouse) (pPB-N-His)
PV248215 500 ng
EUR 603

ZBP1 Protein Vector (Mouse) (pPM-C-HA)
PV248216 500 ng
EUR 603

ZBP1 Protein Vector (Mouse) (pPM-C-His)
PV248217 500 ng
EUR 603

ZBP1 Protein Vector (Mouse) (pPB-C-His)
PV248218 500 ng
EUR 603

ZBP1 Protein Vector (Mouse) (pPB-N-His)
PV248219 500 ng
EUR 603

ZBP1 Protein Vector (Mouse) (pPM-C-HA)
PV248220 500 ng
EUR 603

ZBP1 Protein Vector (Mouse) (pPM-C-His)
PV248221 500 ng
EUR 603

ZBP1 Protein Vector (Human) (pPB-C-His)
PV059885 500 ng
EUR 481

ZBP1 Protein Vector (Human) (pPB-N-His)
PV059886 500 ng
EUR 481

ZBP1 Protein Vector (Human) (pPM-C-HA)
PV059887 500 ng
EUR 481

ZBP1 Protein Vector (Human) (pPM-C-His)
PV059888 500 ng
EUR 481

Recombinant Z-DNA Binding Protein 1 (ZBP1)
4-RPB552Hu01
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9H171
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.4kDa
  • Isoelectric Point: 7.9
Description: Recombinant Human Z-DNA Binding Protein 1 expressed in: E.coli

ZBP1 Protein Vector (Human) (pPB-C-His)
PV046829 500 ng
EUR 329

ZBP1 Protein Vector (Human) (pPB-N-His)
PV046830 500 ng
EUR 329

ZBP1 Protein Vector (Human) (pPM-C-HA)
PV046831 500 ng
EUR 329

ZBP1 Protein Vector (Human) (pPM-C-His)
PV046832 500 ng
EUR 329

Zbp1 3'UTR Luciferase Stable Cell Line
TU122464 1.0 ml Ask for price

ZBP1 3'UTR GFP Stable Cell Line
TU078707 1.0 ml
EUR 2333

Zbp1 3'UTR GFP Stable Cell Line
TU172464 1.0 ml Ask for price

Zbp1 3'UTR Luciferase Stable Cell Line
TU223542 1.0 ml Ask for price

ZBP1 3'UTR Luciferase Stable Cell Line
TU028707 1.0 ml
EUR 2333

Zbp1 3'UTR GFP Stable Cell Line
TU273542 1.0 ml Ask for price

Human Z-DNA Binding Protein 1 (ZBP1) Protein
20-abx069716
  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ZBP1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV705195 1.0 ug DNA
EUR 450

ZBP1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV705199 1.0 ug DNA
EUR 450

ZBP1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV705200 1.0 ug DNA
EUR 450

GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

ZBP1 Rabbit Polyclonal Antibody