ZBP1 Rabbit Polyclonal Antibody
ZBP1 Polyclonal Antibody |
ABP60951-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human ZBP1 protein at amino acid sequence of 21-70
- Applications tips:
|
Description: A polyclonal antibody for detection of ZBP1 from Human. This ZBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ZBP1 protein at amino acid sequence of 21-70 |
ZBP1 Polyclonal Antibody |
ABP60951-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human ZBP1 protein at amino acid sequence of 21-70
- Applications tips:
|
Description: A polyclonal antibody for detection of ZBP1 from Human. This ZBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ZBP1 protein at amino acid sequence of 21-70 |
ZBP1 Polyclonal Antibody |
ABP60951-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human ZBP1 protein at amino acid sequence of 21-70
- Applications tips:
|
Description: A polyclonal antibody for detection of ZBP1 from Human. This ZBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ZBP1 protein at amino acid sequence of 21-70 |
ZBP1 Polyclonal Antibody |
ES11422-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ZBP1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
ZBP1 Polyclonal Antibody |
ES11422-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ZBP1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
ZBP1 Rabbit pAb |
A13899-100ul |
Abclonal |
100 ul |
EUR 308 |
ZBP1 Rabbit pAb |
A13899-200ul |
Abclonal |
200 ul |
EUR 459 |
ZBP1 Rabbit pAb |
A13899-20ul |
Abclonal |
20 ul |
EUR 183 |
ZBP1 Rabbit pAb |
A13899-50ul |
Abclonal |
50 ul |
EUR 223 |
ZBP1 Polyclonal Conjugated Antibody |
C28403 |
SAB |
100ul |
EUR 397 |
ZBP1 Antibody |
24608-100ul |
SAB |
100ul |
EUR 390 |
ZBP1 antibody |
70R-1257 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal ZBP1 antibody raised against the middle region of ZBP1 |
ZBP1 antibody |
70R-21368 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal ZBP1 antibody |
ZBP1 Antibody |
1-CSB-PA026311GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against ZBP1. Recognizes ZBP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
Rabbit ZBP1 ELISA Kit |
ERTZ0008 |
Abclonal |
96Tests |
EUR 521 |
anti- ZBP1 antibody |
FNab09586 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:500-1:5000
- IHC: 1:20-1:200
- Immunogen: Z-DNA binding protein 1
- Uniprot ID: Q9H171
- Gene ID: 81030
|
Description: Antibody raised against ZBP1 |
Anti-ZBP1 antibody |
STJ115838 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a Z-DNA binding protein. The encoded protein plays a role in the innate immune response by binding to foreign DNA and inducing type-I interferon production. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. |
Anti-ZBP1 antibody |
STJ192580 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to ZBP1 |
ZBP1 siRNA |
20-abx940166 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ZBP1 siRNA |
20-abx940167 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ZBP1 cloning plasmid |
CSB-CL861990HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 450
- Sequence: atggcccaggctcctgctgacccgggcagagaaggccaccttgaacaaagaatcctgcaggtgctgacagaggctggctccccggtgaaacttgcccagctggtgaaggaatgccaagcacccaagagggagctcaaccaagtcctctaccgaatgaaaaaggagttgaaagtctc
- Show more
|
Description: A cloning plasmid for the ZBP1 gene. |
ZBP1 cloning plasmid |
CSB-CL861990HU2-10ug |
Cusabio |
10ug |
EUR 471 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1290
- Sequence: ATGGCCCAGGCTCCTGCTGACCCGGGCAGAGAAGGCCACCTTGAACAAAGAATCCTGCAGGTGCTGACAGAGGCTGGCTCCCCGGTGAAACTTGCCCAGCTGGTGAAGGAATGCCAAGCACCCAAGAGGGAGCTCAACCAAGTCCTCTACCGAATGAAAAAGGAGTTGAAAGTCT
- Show more
|
Description: A cloning plasmid for the ZBP1 gene. |
Z-DNA Binding Protein 1 (ZBP1) Polyclonal Antibody (Human) |
4-PAB552Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ZBP1 (Arg10~Pro167)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Z-DNA Binding Protein 1 (ZBP1) |
Human ZBP1 ELISA Kit |
EHZ0008 |
Abclonal |
96Tests |
EUR 521 |
Bovine ZBP1 ELISA Kit |
EBZ0008 |
Abclonal |
96Tests |
EUR 521 |
Anserini ZBP1 ELISA Kit |
EAZ0008 |
Abclonal |
96Tests |
EUR 521 |
Chicken ZBP1 ELISA Kit |
ECKZ0008 |
Abclonal |
96Tests |
EUR 521 |
Canine ZBP1 ELISA Kit |
ECZ0008 |
Abclonal |
96Tests |
EUR 521 |
Goat ZBP1 ELISA Kit |
EGTZ0008 |
Abclonal |
96Tests |
EUR 521 |
Mouse ZBP1 shRNA Plasmid |
20-abx975072 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human ZBP1 shRNA Plasmid |
20-abx962944 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Sheep ZBP1 ELISA Kit |
ESZ0008 |
Abclonal |
96Tests |
EUR 521 |
Porcine ZBP1 ELISA Kit |
EPZ0008 |
Abclonal |
96Tests |
EUR 521 |
Rat ZBP1 ELISA Kit |
ERZ0008 |
Abclonal |
96Tests |
EUR 521 |
Monkey ZBP1 ELISA Kit |
EMKZ0008 |
Abclonal |
96Tests |
EUR 521 |
Mouse ZBP1 ELISA Kit |
EMZ0008 |
Abclonal |
96Tests |
EUR 521 |
ZBP1 Recombinant Protein (Human) |
RP044914 |
ABM |
100 ug |
Ask for price |
ZBP1 Recombinant Protein (Human) |
RP035122 |
ABM |
100 ug |
Ask for price |
ZBP1 Recombinant Protein (Mouse) |
RP186158 |
ABM |
100 ug |
Ask for price |
ZBP1 Recombinant Protein (Mouse) |
RP186161 |
ABM |
100 ug |
Ask for price |
Z-DNA Binding Protein 1 (ZBP1) Polyclonal Antibody (Human), APC |
4-PAB552Hu01-APC |
Cloud-Clone |
-
EUR 333.00
-
EUR 3113.00
-
EUR 872.00
-
EUR 423.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ZBP1 (Arg10~Pro167)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Z-DNA Binding Protein 1 (ZBP1). This antibody is labeled with APC. |
Z-DNA Binding Protein 1 (ZBP1) Polyclonal Antibody (Human), Biotinylated |
4-PAB552Hu01-Biotin |
Cloud-Clone |
-
EUR 303.00
-
EUR 2341.00
-
EUR 697.00
-
EUR 369.00
-
EUR 216.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ZBP1 (Arg10~Pro167)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Z-DNA Binding Protein 1 (ZBP1). This antibody is labeled with Biotin. |
Z-DNA Binding Protein 1 (ZBP1) Polyclonal Antibody (Human), Cy3 |
4-PAB552Hu01-Cy3 |
Cloud-Clone |
-
EUR 403.00
-
EUR 4109.00
-
EUR 1121.00
-
EUR 523.00
-
EUR 245.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ZBP1 (Arg10~Pro167)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Z-DNA Binding Protein 1 (ZBP1). This antibody is labeled with Cy3. |
Z-DNA Binding Protein 1 (ZBP1) Polyclonal Antibody (Human), FITC |
4-PAB552Hu01-FITC |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ZBP1 (Arg10~Pro167)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Z-DNA Binding Protein 1 (ZBP1). This antibody is labeled with FITC. |
Z-DNA Binding Protein 1 (ZBP1) Polyclonal Antibody (Human), HRP |
4-PAB552Hu01-HRP |
Cloud-Clone |
-
EUR 305.00
-
EUR 2714.00
-
EUR 772.00
-
EUR 383.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ZBP1 (Arg10~Pro167)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Z-DNA Binding Protein 1 (ZBP1). This antibody is labeled with HRP. |
Z-DNA Binding Protein 1 (ZBP1) Polyclonal Antibody (Human), PE |
4-PAB552Hu01-PE |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ZBP1 (Arg10~Pro167)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Z-DNA Binding Protein 1 (ZBP1). This antibody is labeled with PE. |
Z-DNA Binding Protein 1 (ZBP1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAB552Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 547.00
-
EUR 6106.00
-
EUR 1624.00
-
EUR 727.00
-
EUR 310.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ZBP1 (Arg10~Pro167)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Z-DNA Binding Protein 1 (ZBP1). This antibody is labeled with APC-Cy7. |
Z-DNA-Binding Protein 1 (ZBP1) Antibody |
20-abx003826 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Z-DNA Binding Protein 1 (ZBP1) Antibody |
20-abx102404 |
Abbexa |
-
EUR 300.00
-
EUR 133.00
-
EUR 787.00
-
EUR 411.00
-
EUR 258.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Z-Dna Binding Protein 1 (ZBP1) Antibody |
20-abx116709 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Z-DNA-Binding Protein 1 (ZBP1) Antibody |
abx239586-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Z-DNA-Binding Protein 1 (ZBP1) Antibody |
abx412058-01mg |
Abbexa |
0.1 mg |
EUR 537 |
|
Z-DNA-Binding Protein 1 (ZBP1) Antibody |
abx412059-50ug |
Abbexa |
50 ug |
EUR 356 |
|
Z-DNA-Binding Protein 1 (ZBP1) Antibody |
abx430069-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Guinea Pig ZBP1 ELISA Kit |
EGZ0008 |
Abclonal |
96Tests |
EUR 521 |
Zbp1 ORF Vector (Mouse) (pORF) |
ORF062054 |
ABM |
1.0 ug DNA |
EUR 506 |
Zbp1 ORF Vector (Mouse) (pORF) |
ORF062055 |
ABM |
1.0 ug DNA |
EUR 506 |
ZBP1 ORF Vector (Human) (pORF) |
ORF011708 |
ABM |
1.0 ug DNA |
EUR 95 |
ZBP1 ORF Vector (Human) (pORF) |
ORF014972 |
ABM |
1.0 ug DNA |
EUR 354 |
ZBP1 Western Blot kit (AWBK36711) |
AWBK36711 |
Aviva Systems Biology |
10 reactions |
EUR 647 |
Description: - Description of target:
- Species reactivity:
- Application:
- Assay info:
- Sensitivity:
|
ZBP1 ELISA Kit (Human) (OKCA00862) |
OKCA00862 |
Aviva Systems Biology |
96 Wells |
EUR 833 |
Description: Description of target: Participates in the detection by the host's innate immune system of DNA from viral, bacterial or even host origin. Plays a role in host defense against tumors and pathogens. Acts as a cytoplasmic DNA sensor which, when activated, induces the recruitment of TBK1 and IRF3 to its C-terminal region and activates the downstream interferon regulatory factor (IRF) and NF-kappa B transcription factors, leading to type-I interferon production. ZBP1-induced NF-kappaB activation probably involves the recruitment of the RHIM containing kinases RIPK1 and RIPK3.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.86 pg/mL |
ZBP1 sgRNA CRISPR Lentivector set (Human) |
K2660101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Zbp1 sgRNA CRISPR Lentivector set (Mouse) |
K4373001 |
ABM |
3 x 1.0 ug |
EUR 339 |
ZBP1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2660102 |
ABM |
1.0 ug DNA |
EUR 154 |
ZBP1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2660103 |
ABM |
1.0 ug DNA |
EUR 154 |
ZBP1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2660104 |
ABM |
1.0 ug DNA |
EUR 154 |
Zbp1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4373002 |
ABM |
1.0 ug DNA |
EUR 154 |
Zbp1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4373003 |
ABM |
1.0 ug DNA |
EUR 154 |
Zbp1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4373004 |
ABM |
1.0 ug DNA |
EUR 154 |
ZBP1 Protein Vector (Mouse) (pPB-C-His) |
PV248214 |
ABM |
500 ng |
EUR 603 |
ZBP1 Protein Vector (Mouse) (pPB-N-His) |
PV248215 |
ABM |
500 ng |
EUR 603 |
ZBP1 Protein Vector (Mouse) (pPM-C-HA) |
PV248216 |
ABM |
500 ng |
EUR 603 |
ZBP1 Protein Vector (Mouse) (pPM-C-His) |
PV248217 |
ABM |
500 ng |
EUR 603 |
ZBP1 Protein Vector (Mouse) (pPB-C-His) |
PV248218 |
ABM |
500 ng |
EUR 603 |
ZBP1 Protein Vector (Mouse) (pPB-N-His) |
PV248219 |
ABM |
500 ng |
EUR 603 |
ZBP1 Protein Vector (Mouse) (pPM-C-HA) |
PV248220 |
ABM |
500 ng |
EUR 603 |
ZBP1 Protein Vector (Mouse) (pPM-C-His) |
PV248221 |
ABM |
500 ng |
EUR 603 |
ZBP1 Protein Vector (Human) (pPB-C-His) |
PV059885 |
ABM |
500 ng |
EUR 481 |
ZBP1 Protein Vector (Human) (pPB-N-His) |
PV059886 |
ABM |
500 ng |
EUR 481 |
ZBP1 Protein Vector (Human) (pPM-C-HA) |
PV059887 |
ABM |
500 ng |
EUR 481 |
ZBP1 Protein Vector (Human) (pPM-C-His) |
PV059888 |
ABM |
500 ng |
EUR 481 |
Recombinant Z-DNA Binding Protein 1 (ZBP1) |
4-RPB552Hu01 |
Cloud-Clone |
-
EUR 530.08
-
EUR 245.00
-
EUR 1712.80
-
EUR 637.60
-
EUR 1175.20
-
EUR 418.00
-
EUR 4132.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9H171
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 19.4kDa
- Isoelectric Point: 7.9
|
Description: Recombinant Human Z-DNA Binding Protein 1 expressed in: E.coli |
ZBP1 Protein Vector (Human) (pPB-C-His) |
PV046829 |
ABM |
500 ng |
EUR 329 |
ZBP1 Protein Vector (Human) (pPB-N-His) |
PV046830 |
ABM |
500 ng |
EUR 329 |
ZBP1 Protein Vector (Human) (pPM-C-HA) |
PV046831 |
ABM |
500 ng |
EUR 329 |
ZBP1 Protein Vector (Human) (pPM-C-His) |
PV046832 |
ABM |
500 ng |
EUR 329 |
Zbp1 3'UTR Luciferase Stable Cell Line |
TU122464 |
ABM |
1.0 ml |
Ask for price |
ZBP1 3'UTR GFP Stable Cell Line |
TU078707 |
ABM |
1.0 ml |
EUR 2333 |
Zbp1 3'UTR GFP Stable Cell Line |
TU172464 |
ABM |
1.0 ml |
Ask for price |
Zbp1 3'UTR Luciferase Stable Cell Line |
TU223542 |
ABM |
1.0 ml |
Ask for price |
ZBP1 3'UTR Luciferase Stable Cell Line |
TU028707 |
ABM |
1.0 ml |
EUR 2333 |
Zbp1 3'UTR GFP Stable Cell Line |
TU273542 |
ABM |
1.0 ml |
Ask for price |
Human Z-DNA Binding Protein 1 (ZBP1) Protein |
20-abx069716 |
Abbexa |
-
EUR 732.00
-
EUR 286.00
-
EUR 2305.00
-
EUR 885.00
-
EUR 523.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
ZBP1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV705195 |
ABM |
1.0 ug DNA |
EUR 450 |
ZBP1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV705199 |
ABM |
1.0 ug DNA |
EUR 450 |
ZBP1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV705200 |
ABM |
1.0 ug DNA |
EUR 450 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
ZBP1 Rabbit Polyclonal Antibody